BSN (2 of 2)

Ensembl ID:
ENSDARG00000079822
Description:
bassoon (presynaptic cytomatrix protein) [Source:HGNC Symbol;Acc:1117]
Human Orthologue:
BSN
Human Description:
bassoon (presynaptic cytomatrix protein) [Source:HGNC Symbol;Acc:1117]
Mouse Orthologue:
Bsn
Mouse Description:
bassoon Gene [Source:MGI Symbol;Acc:MGI:1277955]

Alleles

There are 17 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21405 Nonsense Mutation detected in F1 DNA During 2014
sa14012 Nonsense Available for shipment Available now
sa16623 Nonsense Available for shipment Available now
sa3682 Nonsense Mutation detected in F1 DNA During 2014
sa5514 Nonsense Mutation detected in F1 DNA During 2014
sa13749 Nonsense Available for shipment Available now
sa8919 Nonsense Mutation detected in F1 DNA During 2014
sa11540 Nonsense Available for shipment Available now
sa9997 Nonsense Available for shipment Available now
sa21404 Nonsense Mutation detected in F1 DNA During 2014
sa21403 Nonsense Mutation detected in F1 DNA During 2014
sa7284 Nonsense Mutation detected in F1 DNA During 2014
sa2454 Nonsense F2 line generated During 2014
sa21402 Nonsense Mutation detected in F1 DNA During 2014
sa25413 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7165 Nonsense Mutation detected in F1 DNA During 2014
sa11595 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Nonsense 20 3782 1 18
ENSDART00000114444 None None 3719 None 19
ENSDART00000122421 None None 3727 None 19
Genomic Location:
Chromosome 8 (position 55824557)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGAGGTCCACCAACAAGTCCAAAACTAGGCTATGGAGCTGGTAGTGAT[C/T]GAGGGCCGGGTGCTGACTTTGGCACGGGTGGAATGCAAACAAGTGCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14012
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Nonsense 45 3782 1 18
ENSDART00000114444 Nonsense 16 3719 1 19
ENSDART00000122421 None None 3727 None 19
ENSDART00000111967 Nonsense 45 3782 1 18
ENSDART00000114444 Nonsense 16 3719 1 19
ENSDART00000122421 None None 3727 None 19
Genomic Location:
Chromosome 8 (position 55824482)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGTGGAATGCAAACAAGTGCAAACCCTTACAAAAAGCAAATCCATGAT[G/T]GACCMAGACATTCCCAGACTACGCCTACGCATCAGTCTCAAATTCAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16623
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Nonsense 45 3782 1 18
ENSDART00000114444 Nonsense 16 3719 1 19
ENSDART00000122421 None None 3727 None 19
ENSDART00000111967 Nonsense 45 3782 1 18
ENSDART00000114444 Nonsense 16 3719 1 19
ENSDART00000122421 None None 3727 None 19
Genomic Location:
Chromosome 8 (position 55824482)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGTGGAATGCAAACAAGTGCAAACCCTTACAAAAAGCAAATCCATGAT[G/T]GACCMAGACATTCCCAGACTACRCCTACGCATCAGTCTCAAATTCAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Nonsense 70 3782 1 18
ENSDART00000114444 Nonsense 41 3719 1 19
ENSDART00000122421 None None 3727 None 19
Genomic Location:
Chromosome 8 (position 55824407)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACGCATCAGTCTCAAATTCAAGCTTCARCAGGGGGCATGGGAGCCAAC[C/T]AGAGCCCGGGCCAGCACGCCTCCAGACGCAACCTCCAAGTGGACTTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Nonsense 817 3782 8 18
ENSDART00000114444 Nonsense 761 3719 9 19
ENSDART00000122421 Nonsense 746 3727 9 19
Genomic Location:
Chromosome 8 (position 55812976)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCAAAAGCACATCAGCGACTCAGGAAAAGAAAAGCGTCGTCTYACTTA[T/A]CATTCGAGTAGCTTTGAGGAGGAGAGTAAAACCACAAGTGATATATACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13749
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Nonsense 1077 3782 8 18
ENSDART00000114444 Nonsense 1021 3719 9 19
ENSDART00000122421 Nonsense 1006 3727 9 19
Genomic Location:
Chromosome 8 (position 55812197)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCAAGCTGTACAAATCTGGTAGTGAGTACAACCTGCCCACCTTTATGT[C/A]ACYTTATTCTCCTACTGAAAAGCCAGAAACTACATCATCTACTGCTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Nonsense 1222 3782 8 18
ENSDART00000114444 Nonsense 1166 3719 9 19
ENSDART00000122421 Nonsense 1151 3727 9 19
Genomic Location:
Chromosome 8 (position 55811763)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAAAAGCAGTTACKAGATACAGGCTCAGCYTTTGCTAAGTTGCTGGAA[C/T]AAAGCAATGCTTTACTGACTCCTGGAACAAGCCCCACCCAGCTCTCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11540
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Nonsense 1458 3782 8 18
ENSDART00000114444 Nonsense 1402 3719 9 19
ENSDART00000122421 Nonsense 1387 3727 9 19
Genomic Location:
Chromosome 8 (position 55811053)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGTTGTTACACCAGGYCTTTTTAGGCAGCAGTCCACTCAAGAYACCTA[T/G]TATAYGATTAGAACAGAGGAGCCTGAGCYCACAAGTCCATCCAAACCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9997
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Nonsense 1849 3782 9 18
ENSDART00000114444 Nonsense 1793 3719 10 19
ENSDART00000122421 Nonsense 1778 3727 10 19
Genomic Location:
Chromosome 8 (position 55809776)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTCCATTCTCTCAGAAACCAGTCACAGATGAGCCTTCCAAGCAATCAT[C/A]AATAGCACCGAYCACATTACCACARCATTATCAGCAGTTTGATTTACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Nonsense 1859 3782 9 18
ENSDART00000114444 Nonsense 1803 3719 10 19
ENSDART00000122421 Nonsense 1788 3727 10 19
Genomic Location:
Chromosome 8 (position 55809745)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCCTTCCAAGCAATCATCAATAGCACCGACCACATTACCACAACATTA[T/A]CAGCAGTTTGATTTACGACAAGATGGGCAGACTTACCAAGATTACACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21403
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Nonsense 2280 3782 10 18
ENSDART00000114444 Nonsense 2224 3719 11 19
ENSDART00000122421 Nonsense 2209 3727 11 19
Genomic Location:
Chromosome 8 (position 55808442)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAACTTTTGCAAATTGAGAGAGAGAGAGTGGAACTGGAAAAGTTGCGT[C/T]AGCTAAGGCTTCAGGAAGAGCTTGAGCGTGAGCGTGCAGAGTTGCAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7284
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Nonsense 2354 3782 10 18
ENSDART00000114444 Nonsense 2298 3719 11 19
ENSDART00000122421 Nonsense 2283 3727 11 19
ENSDART00000111967 Nonsense 2354 3782 10 18
ENSDART00000114444 Nonsense 2298 3719 11 19
ENSDART00000122421 Nonsense 2283 3727 11 19
Genomic Location:
Chromosome 8 (position 55808220)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAYTAGCTCAACAGAAACAGCAGCTTGATCAGATACAATCTTTGCAACAT[C/T]AGTTGCAGCAGCAACTTGAGGAACAAAAGANNNNNNNNNCAGTCAGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2454
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Nonsense 2354 3782 10 18
ENSDART00000114444 Nonsense 2298 3719 11 19
ENSDART00000122421 Nonsense 2283 3727 11 19
ENSDART00000111967 Nonsense 2354 3782 10 18
ENSDART00000114444 Nonsense 2298 3719 11 19
ENSDART00000122421 Nonsense 2283 3727 11 19
Genomic Location:
Chromosome 8 (position 55808220)
KASP Assay ID:
554-3184.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAYTAGCTCAACAGAAACAGCAGCTTGATCAGATACAATCTTTGCAACAT[C/T]AGTTGCAGCAGCAACTTGAGGAACAAAAGANNNNNNNNNCAGTCAGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Nonsense 2629 3782 10 18
ENSDART00000114444 Nonsense 2573 3719 11 19
ENSDART00000122421 Nonsense 2558 3727 11 19
Genomic Location:
Chromosome 8 (position 55807395)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCGGTGTCCATTTAGTTGGTTCTGCAGATCCACTCTCACCAAGTCAT[C/T]AGAATGCCGTGAAGTTTGGAAGGCGGAGGCCCGATCCTTTGGAGTTTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Essential Splice Site 2757 3782 None 18
ENSDART00000114444 Essential Splice Site 2701 3719 None 19
ENSDART00000122421 Essential Splice Site 2686 3727 None 19
Genomic Location:
Chromosome 8 (position 55807007)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCAAGGCTAGGATTTCACTTTATCAACAGCAAGCCCTTCAGAGTCAGG[T/A]ATGGGTAATTCATTTTTTGATTCTTAACTTGCACTTGCTTTGCACAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Nonsense 3043 3782 13 18
ENSDART00000114444 Nonsense 2987 3719 14 19
ENSDART00000122421 Nonsense 2986 3727 13 19
Genomic Location:
Chromosome 8 (position 55805334)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAGACAGACATCACTTGCTGACCTTGAACACAAAATGCCCACTAATTA[T/A]GAAGTTATAAGCAATCCCACAGTTGTAGTCACAACCACTGCCCAAGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111967 Nonsense 3621 3782 15 18
ENSDART00000114444 Nonsense 3566 3719 16 19
ENSDART00000122421 Nonsense 3564 3727 15 19
Genomic Location:
Chromosome 8 (position 55802872)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTYAGGTTCCAGTAGGCAAGGTGTCTCCCAGCCTCCAGTTGATGGGCAG[C/T]AAGGGCAGCGAACGCAACTTCAACAGCAGGCACAGACTTCAGCAGCCAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Type 2 diabetes: Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lvxi0ivj