helq

Ensembl ID:
ENSDARG00000079818
ZFIN ID:
ZDB-GENE-060503-421
Description:
Novel protein similar to vertebrate DNA helicase HEL308 (HEL308) [Source:UniProtKB/TrEMBL;Acc:Q1LVP8
Human Orthologue:
HELQ
Human Description:
helicase, POLQ-like [Source:HGNC Symbol;Acc:18536]
Mouse Orthologue:
Helq
Mouse Description:
helicase, POLQ-like Gene [Source:MGI Symbol;Acc:MGI:2176740]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6669 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23901 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6669
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109412 Essential Splice Site 259 1010 3 18
ENSDART00000147372   1 711 1 15
Genomic Location (Zv9):
Chromosome 21 (position 18149308)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19297560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATTCAAATTTTGGTTTTGTAAGTANNTTTTTTTATTTGCTTTTRATTTC[A/G]GAGTGGCAGAAGACYTGTTTGAGCCTGGATTCAATTCAGCAGAGGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23901
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109412 Nonsense 943 1010 17 18
ENSDART00000147372 Nonsense 644 711 14 15
Genomic Location (Zv9):
Chromosome 21 (position 18160883)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19309135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGCTCATTTTGTTTTTTATTCTCTTTTGATTATAGCATCGTGCTAAG[C/T]AGCTGTACAGTGCCGGATACAAGACATTATCACATCTGGCCAATGCAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link