rhbdd3

Ensembl ID:
ENSDARG00000079816
ZFIN ID:
ZDB-GENE-070705-39
Description:
rhomboid domain-containing protein 3 [Source:RefSeq peptide;Acc:NP_001121831]
Human Orthologue:
RHBDD3
Human Description:
rhomboid domain containing 3 [Source:HGNC Symbol;Acc:1308]
Mouse Orthologue:
Rhbdd3
Mouse Description:
rhomboid domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2444684]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15827 Nonsense Available for shipment Available now
sa6975 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111302 Nonsense 137 348 2 5
Genomic Location:
Chromosome 5 (position 26552304)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTCTCWGGATACGCAGCCATTCACCTCGCCCTKCTCACGGCTCAGWGY[C/T]KACAGGTCAAGCAGAGGAGAGTCCTGCGCTTTGTTCCTGTCTGGTTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111302 Nonsense 137 348 2 5
Genomic Location:
Chromosome 5 (position 26552304)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTCTCTGGATACGCAGCCATTCACCTCGCCCTKCTCACGGCTCAGWGT[C/T]GACAGGTCAAGCAGAGGAGAGTCCTGCGCTTTGTTCCTGTCTGGTTCTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rn5kkaj8