rhbdd3

Ensembl ID:
ENSDARG00000079816
ZFIN ID:
ZDB-GENE-070705-39
Description:
rhomboid domain-containing protein 3 [Source:RefSeq peptide;Acc:NP_001121831]
Human Orthologue:
RHBDD3
Human Description:
rhomboid domain containing 3 [Source:HGNC Symbol;Acc:1308]
Mouse Orthologue:
Rhbdd3
Mouse Description:
rhomboid domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2444684]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15827 Nonsense Available for shipment Available now
sa6975 Nonsense Mutation detected in F1 DNA During 2015
sa30616 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa15827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111302 Nonsense 137 348 2 5
Genomic Location:
Chromosome 5 (position 26552304)
KASP Assay ID:
554-4919.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTCTCWGGATACGCAGCCATTCACCTCGCCCTKCTCACGGCTCAGWGY[C/T]KACAGGTCAAGCAGAGGAGAGTCCTGCGCTTTGTTCCTGTCTGGTTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111302 Nonsense 137 348 2 5
Genomic Location:
Chromosome 5 (position 26552304)
KASP Assay ID:
554-4919.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTCTCTGGATACGCAGCCATTCACCTCGCCCTKCTCACGGCTCAGWGT[C/T]GACAGGTCAAGCAGAGGAGAGTCCTGCGCTTTGTTCCTGTCTGGTTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111302 Nonsense 216 348 3 5
Genomic Location:
Chromosome 5 (position 26554557)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTGCCTGCTTGCCAAAATGGGCCTACATCCCAGTCACCTCTCGTTCG[C/T]AGCTACCAGTTTACAACAACACCTCAACAAGGTCAGTTCAATCTCTTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rn5kkaj8