LOC100149741

Ensembl ID:
ENSDARG00000079811
Human Orthologue:
MICAL1
Human Description:
microtubule associated monoxygenase, calponin and LIM domain containing 1 [Source:HGNC Symbol;Acc:20
Mouse Orthologue:
Mical1
Mouse Description:
microtubule associated monoxygenase, calponin and LIM domain containing 1 Gene [Source:MGI Symbol;Ac

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10835 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10835
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113911 Nonsense 580 867 9 16
Genomic Location:
Chromosome 6 (position 23243104)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACTCCAGCCTCTGCCTTGTCTCAAAAAGCTGAGCTTCAGCCTCGCTG[T/A]TCTCCAAACCTGTMTCCTCCACCTCCCCCACCGACCAATACCAGCTCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0o4fxqup