NP_001091731.1

Ensembl ID:
ENSDARG00000079808
Description:
hypothetical protein LOC100002730 [Source:RefSeq peptide;Acc:NP_001091731]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6920 Nonsense Mutation detected in F1 DNA During 2017
sa33324 Nonsense Mutation detected in F1 DNA During 2017
sa25263 Nonsense Mutation detected in F1 DNA During 2017
sa33323 Nonsense Mutation detected in F1 DNA During 2017
sa17054 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111791 Nonsense 125 900 3 12
Genomic Location (Zv9):
Chromosome 3 (position 55371192)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54264918
KASP Assay ID:
554-4466.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTATCAGCGCCTTGAATCACAYTGGACCAATGATAGAGGGAATTCAGWA[T/A]GAGMTCCAGTGTGATGTTTACAATGTGGCTCCTGCTCARAGTSTCACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33324
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111791 Nonsense 153 900 3 12
Genomic Location (Zv9):
Chromosome 3 (position 55371110)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54264836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTCAAAGTCTCACTGTCAACTGGTACAAAGGAAAAACTCTGGTGAAT[C/T]AAACCAGCTTCACTGACACCAGCAAGAGTTCAGTCAACATGACATCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111791 Nonsense 260 900 4 12
Genomic Location (Zv9):
Chromosome 3 (position 55370071)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54263797
KASP Assay ID:
554-7385.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGGGCTTGAGTTGGGAGCTAAATGAAGAGACAGTGGAGATCACTAGT[G/T]AGATCTCCAAAACCGTGGATCAAATGACGGAGTGGGAGGGCAAATTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111791 Nonsense 631 900 9 12
Genomic Location (Zv9):
Chromosome 3 (position 55365068)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54258794
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCTGGTCACCAAAGAAAGGGTCTACCTTAGATTCATATCCAAAACATT[T/A]ACATTCTGTTGTGGGCAACCCCCATCCAAGCATCTCCTGGAAACATAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111791 Nonsense 645 900 9 12
Genomic Location (Zv9):
Chromosome 3 (position 55365027)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54258753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAACATTTACATTCTGTTGTGGGCAACCCCCAYCCAAGCATCTCCTGG[A/T]AAYAYAATTCATYGCCAGTCAATGCTTCTGCACCTCTTACMGAAACWGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link