ENSDARG00000079791

Ensembl ID:
ENSDARG00000079791
Human Orthologue:
RASIP1
Human Description:
Ras interacting protein 1 [Source:HGNC Symbol;Acc:24716]
Mouse Orthologue:
Rasip1
Mouse Description:
Ras interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917153]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17863 Nonsense Available for shipment Available now
sa9151 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19016 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21990 Missense Mutation detected in F1 DNA During 2014
sa17396 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17863
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111976 Nonsense 102 1012 3 28
Genomic Location:
Chromosome 12 (position 877214)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTCTATTCCCGCAGGTATTCAGTGAGTAAAGCAGACGCGGGTGAGTA[T/A]GTGCTGTGYGATGTGATTGGCTGYGTGGTGAACCACAGCTGGAGGACGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9151
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111976 Essential Splice Site 168 1012 3 28
Genomic Location:
Chromosome 12 (position 877014)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCACGCTGGAGGAACAAMACTCCAGAGACGAGGACACGCKGACMGCTG[G/A]TACGACACACACAATRACAGTAATTAGCAGACAGCAGATTGTGTTTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111976 Essential Splice Site 305 1012 7 28
Genomic Location:
Chromosome 12 (position 872564)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGCGTCACTGCTGCATCCGGCGAAAGGACATCAACACTGGACCCAG[G/T]TTATTATAGCTTATTTTGAAAAAAAGTTTTATTTTGATACTACACTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111976 Missense 480 1012 15 28
Genomic Location:
Chromosome 12 (position 868590)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTATTAATGTCTTCATCTGTCAGTAAATCTCTCCTCCTGCTGCTGCA[G/A]TGACCGTGAGCTGCTGGTGGCTCTGGAAGCGATGCTCTTCTGGATGTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17396
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111976 Essential Splice Site 891 1012 25 28
Genomic Location:
Chromosome 12 (position 858932)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACTTTTCTCTAATTGGTCAGATGGCYCMTACTCTCCTCTAATTGGTCA[G/A]ATGTCCAATRTTCTAAACTGATTGGTCAAATTACCCCACTCTACTTTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/abkhkjj9