fam171a1

Ensembl ID:
ENSDARG00000079788
ZFIN ID:
ZDB-GENE-061208-1
Human Orthologue:
FAM171A1
Human Description:
family with sequence similarity 171, member A1 [Source:HGNC Symbol;Acc:23522]
Mouse Orthologue:
Fam171a1
Mouse Description:
family with sequence similarity 171, member A1 Gene [Source:MGI Symbol;Acc:MGI:2442917]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15232 Nonsense Available for shipment Available now
sa42738 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15232
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109450 Nonsense 337 888 8 9
Genomic Location (Zv9):
Chromosome 16 (position 30801372)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28638510
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTNAATTCAGTAGTCAAMTTGAACAATGCTTCTGTGTTTCAGGAGGAAGTG[T/A]ACCCGTTTGCGGCCTGCTCACCGGAAGTTCACATTATCCTCAGCTTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42738
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109450 Nonsense 358 888 8 9
Genomic Location (Zv9):
Chromosome 16 (position 30801433)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28638571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCTGCTCACCGGAAGTTCACATTATCCTCAGCTTTGGATGGCTCTAAA[C/T]GAGACCAGGCTACTTCCATGTCCCACCTTAACCTCATCAATGAGACTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link