fam171a1

Ensembl ID:
ENSDARG00000079788
ZFIN ID:
ZDB-GENE-061208-1
Human Orthologue:
FAM171A1
Human Description:
family with sequence similarity 171, member A1 [Source:HGNC Symbol;Acc:23522]
Mouse Orthologue:
Fam171a1
Mouse Description:
family with sequence similarity 171, member A1 Gene [Source:MGI Symbol;Acc:MGI:2442917]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15232 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15232
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109450 Nonsense 337 888 8 9
Genomic Location:
Chromosome 16 (position 30801372)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTNAATTCAGTAGTCAAMTTGAACAATGCTTCTGTGTTTCAGGAGGAAGTG[T/A]ACCCGTTTGCGGCCTGCTCACCGGAAGTTCACATTATCCTCAGCTTTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xprvlsn6