HNRNPUL1 (1 of 2)

Ensembl ID:
ENSDARG00000079780
Description:
heterogeneous nuclear ribonucleoprotein U-like 1 [Source:HGNC Symbol;Acc:17011]
Human Orthologue:
HNRNPUL1
Human Description:
heterogeneous nuclear ribonucleoprotein U-like 1 [Source:HGNC Symbol;Acc:17011]
Mouse Orthologue:
Hnrnpul1
Mouse Description:
heterogeneous nuclear ribonucleoprotein U-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443517]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10200 Essential Splice Site Available for shipment Available now
sa25316 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17734 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113508 Essential Splice Site 254 875 4 16
Genomic Location:
Chromosome 5 (position 64864526)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATGAGAGTCGAGGATATGGYTACTACGAGCACCGTGAAGAAAGAAGG[T/G]CAGTTCTGTGTGCTTGGGAYTAYTTTTTTGTGTTGCTCAATCTGACTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113508 Essential Splice Site 526 875 10 16
Genomic Location:
Chromosome 5 (position 64869139)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGAAGTTCAACATCCTGGGCACCAATGCTATCATGGAAAAGATGAAG[G/A]TATGGGTGTTGAATATTTCTAATATTATTATTATGTAGATATATATAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113508 Nonsense 855 875 16 16
Genomic Location:
Chromosome 5 (position 64881710)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGTGGCAGCAGTACTACCAGAACCAGAGCCAGTGGAACCAGTACTA[T/A]AACCAGTACGGCGGTTACGGCAACTACCAGCAGGGAGCTCAAGGCAGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l1xazs2p