HNRNPUL1 (1 of 2)

Ensembl ID:
ENSDARG00000079780
Description:
heterogeneous nuclear ribonucleoprotein U-like 1 [Source:HGNC Symbol;Acc:17011]
Human Orthologue:
HNRNPUL1
Human Description:
heterogeneous nuclear ribonucleoprotein U-like 1 [Source:HGNC Symbol;Acc:17011]
Mouse Orthologue:
Hnrnpul1
Mouse Description:
heterogeneous nuclear ribonucleoprotein U-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443517]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33744 Nonsense Mutation detected in F1 DNA During 2016
sa10200 Essential Splice Site Available for shipment Available now
sa25316 Essential Splice Site Mutation detected in F1 DNA During 2016
sa26603 Nonsense Mutation detected in F1 DNA During 2016
sa17734 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33744
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113508 Nonsense 242 875 4 16
Genomic Location (Zv9):
Chromosome 5 (position 64864487)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61139131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATGACCGACACAGCTCACATAGTCGTAAAAGATCCCATGATGAGAGT[C/T]GAGGATATGGCTACTACGAGCACCGTGAAGAAAGAAGGTCAGTTCTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113508 Essential Splice Site 254 875 4 16
Genomic Location (Zv9):
Chromosome 5 (position 64864526)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61139170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATGAGAGTCGAGGATATGGYTACTACGAGCACCGTGAAGAAAGAAGG[T/G]CAGTTCTGTGTGCTTGGGAYTAYTTTTTTGTGTTGCTCAATCTGACTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113508 Essential Splice Site 526 875 10 16
Genomic Location (Zv9):
Chromosome 5 (position 64869139)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61143783
KASP Assay ID:
554-7675.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGAAGTTCAACATCCTGGGCACCAATGCTATCATGGAAAAGATGAAG[G/A]TATGGGTGTTGAATATTTCTAATATTATTATTATGTAGATATATATAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113508 Nonsense 579 875 12 16
Genomic Location (Zv9):
Chromosome 5 (position 64875538)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61150182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTCTTGTCACCATTGCTAGACAAATGTATATGGATCAGCCCAGAGA[C/T]GAAAAATGCGTCCTTTTGAAGGTTTTCAACGCAAGGCTATTGTAATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113508 Nonsense 855 875 16 16
Genomic Location (Zv9):
Chromosome 5 (position 64881710)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61157200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGTGGCAGCAGTACTACCAGAACCAGAGCCAGTGGAACCAGTACTA[T/A]AACCAGTACGGCGGTTACGGCAACTACCAGCAGGGAGCTCAAGGCAGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link