RADIL_DANRE

Ensembl ID:
ENSDARG00000079779
Description:
Ras-associating and dilute domain-containing protein [Source:UniProtKB/Swiss-Prot;Acc:A7UA95]
Human Orthologue:
RADIL
Human Description:
Ras association and DIL domains [Source:HGNC Symbol;Acc:22226]
Mouse Orthologue:
Radil
Mouse Description:
Ras association and DIL domains Gene [Source:MGI Symbol;Acc:MGI:2443088]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa403 Nonsense Available for shipment Available now
sa3367 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18168 Nonsense Available for shipment Available now
sa4829 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa403
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110154 Nonsense 222 560 4 9
Genomic Location:
Chromosome 1 (position 6574529)
KASP Assay ID:
554-0190.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCTCACTCAATACCAGCTCATGGCTGAACTCGGGCCTCTACCAATCTG[G/A]CAACCCAGCAGTGAAGATGAGGCCTATATCTACAGAACAGGTATGCTGAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa3367
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110154 Essential Splice Site 236 560 5 9
Genomic Location:
Chromosome 1 (position 6574649)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTATGCAAGCATACGCTGTAAATCCCTGTGTGTRTYTCTTTGATA[G/C]TTGATCTACTGGAGAGCTTTGAGAATCACCCTCCTATTGTGCTGCCRAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18168
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110154 Nonsense 459 560 7 9
Genomic Location:
Chromosome 1 (position 6583037)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTTCCCTGTCCCTGTRTCTCATCTGGGCCCAAAGTCTGATGATATCTG[T/A]TCCRTCTTTGTAGTGGAYCTGGATAAAGGACCGTACGGCCTGGGAATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4829
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110154 Nonsense 499 560 8 9
Genomic Location:
Chromosome 1 (position 6583571)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACCCCTCTGAACTCTCCTGGAATCTACATCAGGACTCTGATTCCAGAT[G/T]GACCTGCTGCTGCAGATGGACGACTCTGCATCGGTGACAGGATCCTGGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n40ujho9