si:ch73-60l17.2

Ensembl ID:
ENSDARG00000079777
ZFIN ID:
ZDB-GENE-081104-293
Description:
Novel protein similar to vertebrate MAP6 domain containing 1 (MAP6D1) [Source:UniProtKB/TrEMBL;Acc:B
Human Orthologue:
MAP6D1
Human Description:
MAP6 domain containing 1 [Source:HGNC Symbol;Acc:25753]
Mouse Orthologue:
Map6d1
Mouse Description:
MAP6 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3607784]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19859 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19859
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109145 Essential Splice Site 215 308 1 3
ENSDART00000146380 Essential Splice Site 161 254 1 3
Genomic Location (Zv9):
Chromosome 2 (position 44781570)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44867071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAGCGCAGTGGCAGACCGAGAGCCGGAGATCAGATGAGCTCATACAG[G/A]TACTGCTGCTGATGCTTTAGCTGGAGCTGTTCTTCAGCACTGCAACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link