ENSDARG00000079765

Ensembl ID:
ENSDARG00000079765
Mouse Orthologue:
Ccdc48
Mouse Description:
coiled-coil domain containing 48 Gene [Source:MGI Symbol;Acc:MGI:3611451]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41900 Nonsense Mutation detected in F1 DNA During 2017
sa41901 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41900
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111157 Nonsense 166 583 1 8
Genomic Location (Zv9):
Chromosome 11 (position 39072787)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37639806
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGGAGGAGGACAGCGAGAAGATCCGGACCCGCACAGAGCCTGGATCAT[C/T]AGCAGATCAACACTACTGTGGAGAACAAGAGAAGCGTAGGTAAGAAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111157 Nonsense 186 583 2 8
Genomic Location (Zv9):
Chromosome 11 (position 39074938)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37641957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGATCTAATTTGGCTTCATTTACTGCAGTAGATATAAGCCCGCAGAGA[C/T]GACTGCAGGAGCAGCTGGAGCTGGAGAACGCCAGTCTGAGGGAGCTGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link