SCARF2

Ensembl ID:
ENSDARG00000079757
Description:
scavenger receptor class F, member 2 [Source:HGNC Symbol;Acc:19869]
Human Orthologue:
SCARF2
Human Description:
scavenger receptor class F, member 2 [Source:HGNC Symbol;Acc:19869]
Mouse Orthologue:
Scarf2
Mouse Description:
scavenger receptor class F, member 2 Gene [Source:MGI Symbol;Acc:MGI:1858430]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33538 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33538
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114953 Essential Splice Site 692 745 15 15
Genomic Location (Zv9):
Chromosome 5 (position 12449862)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 10861037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCTTCTTCCCACTTCCAGCAACCTCCAGAAGATGGTGGCTCCTATTTC[A/C]GACTCTACTCCTGAAGCCAAAAGCCCAGAAAAACAAGGGCTCAATGGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link