ENSDARG00000079756

Ensembl ID:
ENSDARG00000079756
Human Orthologue:
AC087465.1
Human Description:
Tyrosine-protein kinase SgK269 [Source:UniProtKB/Swiss-Prot;Acc:Q9H792]
Mouse Orthologue:
C230081A13Rik
Mouse Description:
RIKEN cDNA C230081A13 gene Gene [Source:MGI Symbol;Acc:MGI:2442366]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32513 Nonsense Mutation detected in F1 DNA During 2016
sa44230 Nonsense Mutation detected in F1 DNA During 2016
sa8851 Nonsense Mutation detected in F1 DNA During 2016
sa24602 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111151 Nonsense 222 1725 1 4
Genomic Location:
Chromosome 25 (position 7704860)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGAGTTTCCCTCAGTGACAGCACAGAGGTCATTAGCACTGAGGGTGGA[C/T]GATTCTGCTATCCAGAATTCTCCAGCGATGGTGATGATGAGGAGGAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44230
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111151 Nonsense 746 1725 1 4
Genomic Location:
Chromosome 25 (position 7706432)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTTTAGCCCATAGCAGTTTGGATCGTATTCGTAACCCCAGCAGTGAG[C/T]AACCCCCAGAGGGCAGTAAAGATTGCCAACTTGCATCAAGTGGAAGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111151 Nonsense 1492 1725 4 4
Genomic Location:
Chromosome 25 (position 7718517)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACRTCACGCATTGCGATCTGCGCCTYGAGAACCTCCTCCTGGTACACTG[T/A]CAGCCTGGAAACCCTTGGAACCTGGAGSTCCTGGAACCGAACAACAACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111151 Nonsense 1661 1725 4 4
Genomic Location:
Chromosome 25 (position 7719022)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGAGAGGATCTGTTTAATTCGCTGAACCCTGGAGCCGGGACAGTCCAA[C/T]GACACACTGTCCTGCAGAACTGGCTGGACCTGAAGCGAACACTTATGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link