ENSDARG00000079756

Ensembl ID:
ENSDARG00000079756
Human Orthologue:
AC087465.1
Human Description:
Tyrosine-protein kinase SgK269 [Source:UniProtKB/Swiss-Prot;Acc:Q9H792]
Mouse Orthologue:
C230081A13Rik
Mouse Description:
RIKEN cDNA C230081A13 gene Gene [Source:MGI Symbol;Acc:MGI:2442366]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8851 Nonsense Mutation detected in F1 DNA During 2014
sa24602 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111151 Nonsense 1492 1725 4 4
Genomic Location:
Chromosome 25 (position 7718517)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACRTCACGCATTGCGATCTGCGCCTYGAGAACCTCCTCCTGGTACACTG[T/A]CAGCCTGGAAACCCTTGGAACCTGGAGSTCCTGGAACCGAACAACAACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111151 Nonsense 1661 1725 4 4
Genomic Location:
Chromosome 25 (position 7719022)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGAGAGGATCTGTTTAATTCGCTGAACCCTGGAGCCGGGACAGTCCAA[C/T]GACACACTGTCCTGCAGAACTGGCTGGACCTGAAGCGAACACTTATGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x4mtytnh