si:dkey-202m9.3

Ensembl ID:
ENSDARG00000079752
ZFIN ID:
ZDB-GENE-041111-303
Human Orthologues:
COL6A5, COL6A6
Human Descriptions:
collagen, type VI, alpha 5 [Source:HGNC Symbol;Acc:26674]
collagen, type VI, alpha 6 [Source:HGNC Symbol;Acc:27023]
Mouse Orthologues:
AC119951.1, Col6a4, Col6a6
Mouse Descriptions:
collagen alpha-5(VI) chain precursor [Source:RefSeq peptide;Acc:NP_001161395]
collagen, type VI, alpha 4 Gene [Source:MGI Symbol;Acc:MGI:1915803]
collagen, type VI, alpha 6 Gene [Source:MGI Symbol;Acc:MGI:2444259]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9393 Nonsense Mutation detected in F1 DNA During 2017
sa36205 Nonsense Mutation detected in F1 DNA During 2017
sa17668 Nonsense Available for shipment Available now
sa36207 Nonsense Mutation detected in F1 DNA During 2017
sa39119 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22900 Essential Splice Site Available for shipment Available now
sa565 Nonsense Available for shipment Available now
sa36208 Splice Site Mutation detected in F1 DNA During 2017
sa14196 Nonsense Available for shipment Available now
sa12050 Essential Splice Site Available for shipment Available now
sa5895 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Nonsense 88 2543 1 39
Genomic Location (Zv9):
Chromosome 16 (position 38076959)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36717442
KASP Assay ID:
2261-0054.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCTGTTYAGGAAAATAGACAACCTTCCATACCGAACCGGAGGCACGTA[T/A]ATGGGAAAAGCCATGAATTTYCTAAAGGACAATTACTTCACAAGTGCWGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36205
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Nonsense 191 2543 1 39
Genomic Location (Zv9):
Chromosome 16 (position 38077267)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36717750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGCATTGCAAGGACTGACGACCACTATGAAGGAGACAGTGTGTGTCT[T/G]AATGAGGGATCAGGGGAAAGGTAAAGTACATTTTGCAACCCTGTTTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Nonsense 219 2543 2 39
Genomic Location (Zv9):
Chromosome 16 (position 38081187)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36721670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTACTGATGTAWTTGTGTTGGTGGACAGTACAGCTCAGGGGGAAAYA[C/T]AGCAAATAAGGGAACTTCTCAACCGACTGCTTGTGCAGCTCAATGTGGGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Nonsense 599 2543 4 39
Genomic Location (Zv9):
Chromosome 16 (position 38087158)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36727641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTAATCCTTACCTTCAGGATGTGTGAACACAGAGGAAGCAGACATTTA[T/A]TTCCTGTTGGACAACTCTGGCAGCACTCGCGCCGACTTTGAAGATGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Essential Splice Site 775 2543 4 39
Genomic Location (Zv9):
Chromosome 16 (position 38087686)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36728169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAATGTTCTCAAGCGAGAAATTGTCACAGATATTTGCTCTCAAGAGGG[T/C]AAGAGAGTTATCAAACATATACAGCAACATATTGTTGTTTCTTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Essential Splice Site 1672 2543 17 39
Genomic Location (Zv9):
Chromosome 16 (position 38106298)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36746781
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGAAGCTCAGGAAGCCCAGGACAACGAGGCCTGAGAGGAGATCCGG[T/G]TAGTAGAATTCAGCTGCAAATAAATCTCTTAAAGGGATAGTTCACCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Nonsense 2034 2543 32 39
Genomic Location (Zv9):
Chromosome 16 (position 38113026)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36753509
KASP Assay ID:
554-0475.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGCGAAAAGGCRTCCTGATGAGGAAGGTTGCCATTTTCCTYACTGCT[G/T]GAGAATCTCAAGATTCGATATCTCTCACCACTGCCATTCTAGAGTACAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa36208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Splice Site None 2543 None 39
Genomic Location (Zv9):
Chromosome 16 (position 38114650)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36755133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCCAGAACTTTTTCCACCTATTTATTGTATGATAACATCTTTTCACA[T/A]CCAAGATCCCTGCAGACCAGCTAGAGAATGTGAGGGCACCAACCTGCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14196
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Nonsense 2294 2543 34 39
Genomic Location (Zv9):
Chromosome 16 (position 38115224)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36755707
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTGGGAGACTCCATCGCCTCTAGTCAGGTGGAGGAGCTTGCCAGCTA[T/A]CCTTTAGWACAGCACATCATTCACCTGGGCCACTTGAAACATGGAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12050
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Essential Splice Site 2327 2543 34 39
Genomic Location (Zv9):
Chromosome 16 (position 38115323)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36755806
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAGTACACACAACGCTTCATGAGGACTTTCTTCCATATACTGAGCAG[T/C]AAGGAGTKTTTCATGTTAATGCTGATTTGAWTTGGGTCAAAAGAATTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109703 Essential Splice Site 2484 2543 38 39
Genomic Location (Zv9):
Chromosome 16 (position 38123962)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36764445
KASP Assay ID:
554-3911.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCCTGAAGTAATCCCACAGACACAAGTTGAAACGGCTTTATTTAATGG[T/A]AAGGATTGAGCCACATTTGTAACATTTTCTTGCCTTGTCTGGCTTTTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link