si:ch211-166a6.5

Ensembl ID:
ENSDARG00000079745
ZFIN ID:
ZDB-GENE-030131-9913
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S504]
Human Orthologue:
KIAA0664
Human Description:
KIAA0664 [Source:HGNC Symbol;Acc:29094]
Mouse Orthologue:
1300001I01Rik
Mouse Description:
RIKEN cDNA 1300001I01 gene Gene [Source:MGI Symbol;Acc:MGI:1921398]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38662 Nonsense Mutation detected in F1 DNA During 2017
sa21182 Essential Splice Site Available for shipment Available now
sa7620 Missense Mutation detected in F1 DNA During 2017
sa13449 Essential Splice Site Available for shipment Available now
sa7117 Nonsense Mutation detected in F1 DNA During 2017
sa34285 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114890 Nonsense 100 1315 3 27
ENSDART00000141915   None 717 None 16

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 4693325)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4436356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACTCTTGACCCCATGATGGAGCTCCAGGACATCAAAGGCTTCAAAGCT[G/T]GAGTTACTCTTCGTCTAGTGGAAGGTAAACTGGAGGAGCTCTACTTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114890 Essential Splice Site 254 1315 None 27
ENSDART00000141915   None 717 None 16

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 4683315)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4426346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGCAGTGTGACATCACTTCCTGCCCACGTGGATTTTACCTGAACAGG[T/C]ACGAGAGTTTCATTTCAGAACTGCATTCTGCTCTATTTCTGCATTACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114890 Missense 602 1315 12 27
ENSDART00000141915 Missense 4 717 1 16
Genomic Location (Zv9):
Chromosome 8 (position 4670767)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4413798
KASP Assay ID:
554-4307.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCYTTACCCTCGGGTCTTATGAACGTGATTTGCCTRTATATTTCAGACAT[G/A]CTCAGTTCACGCAGCGAGTGAAGGCTCACTTGGAGGAGAACGGAGGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114890 Essential Splice Site 970 1315 20 27
ENSDART00000141915 Essential Splice Site 372 717 9 16
Genomic Location (Zv9):
Chromosome 8 (position 4656038)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4399069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTYAGTCTKCTGGCAAAAGTTGCYYATGTTCAGGGTCATCCTGCTGAGG[T/C]GTGTTNNNNNNNNNNNNNNGGGTGTGTCTTCCTWCCCAGTGTGTCCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114890 Nonsense 1019 1315 22 27
ENSDART00000141915 Nonsense 421 717 11 16
Genomic Location (Zv9):
Chromosome 8 (position 4653193)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4396224
KASP Assay ID:
554-4069.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRTATCTGTATGCCGGKGGTGAAGCGGCTCTGGCTCAGCGATGTCTTTAT[C/T]GAGCCAAAGTCCTCCTGCTGACGATTCATGGAGGAGATCATCCGTACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114890 Nonsense 1179 1315 27 27
ENSDART00000141915 Nonsense 581 717 16 16
Genomic Location (Zv9):
Chromosome 8 (position 4646714)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4389745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATACGGCTGAATGCTTTTATCATTGTCGCTTAAGCACAAGAATGATG[G/T]AGTTTAAAGAGAAACTGAAAGAGAAGAAAGCAGCAGAAGAGGCAGAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link