mcf2l2

Ensembl ID:
ENSDARG00000079742
Human Orthologue:
MCF2L2
Human Description:
MCF.2 cell line derived transforming sequence-like 2 [Source:HGNC Symbol;Acc:30319]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11210 Nonsense Available for shipment Available now
sa15194 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11210
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115255 Nonsense 60 1072 3 29
Genomic Location:
Chromosome 11 (position 10666883)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGATGCACTAAACTTGATTTATTTGTTTGTTTGTGCAGGAGGAAGAGGA[C/T]AAGAGGGWTCTCCCATYATCACCTTCCCAGAGTTCTCAGGTTTTAATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115255 Nonsense 770 1072 20 29
Genomic Location:
Chromosome 11 (position 10591361)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCGTATCTGCTAAAGCCTGWGCAGAGAATCACCAAATACCAGCTTATGT[T/G]AAAGGTGAGTTAAAGCTGACACTAATATAAAATGAGACTGYATTTAATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pd3mbci0