LOC100332852

Ensembl ID:
ENSDARG00000079740
Human Orthologue:
EFNA2
Human Description:
ephrin-A2 [Source:HGNC Symbol;Acc:3222]
Mouse Orthologue:
Efna2
Mouse Description:
ephrin A2 Gene [Source:MGI Symbol;Acc:MGI:102707]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35052 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112589 Essential Splice Site 167 206 3 4
Genomic Location (Zv9):
Chromosome 11 (position 14875984)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 14577280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTGGTGGAAAGCCATGTTTGAAATTAAAGGTGTATGTCAAGCCTACAA[G/A]TGAGTATGTCTGAGTTTCTGCCATGTATTTAGGGTTTTGTTGATGTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link