kif13ba

Ensembl ID:
ENSDARG00000079731
ZFIN ID:
ZDB-GENE-070521-1
Human Orthologue:
KIF13B
Human Description:
kinesin family member 13B [Source:HGNC Symbol;Acc:14405]
Mouse Orthologue:
Kif13b
Mouse Description:
kinesin family member 13B Gene [Source:MGI Symbol;Acc:MGI:1098265]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16494 Nonsense Available for shipment Available now
sa23032 Essential Splice Site Available for shipment Available now
sa36370 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026264 Nonsense 685 1761 16 40
Genomic Location (Zv9):
Chromosome 17 (position 16097443)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16248271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCATYGCYGAAGAGCTGGACAAGAGAACGRAGTACAGAGTTACTCTA[C/T]AGATCCCYGCCGCAAACCTCAAYGCTAACAGAAAGGTAGACATGTTTTRC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23032
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026264 Essential Splice Site 696 1761 16 40
Genomic Location (Zv9):
Chromosome 17 (position 16097480)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16248308
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGTTACTCTACAGATCCCTGCCGCAAACCTCAACGCTAACAGAAAGG[T/C]AGACATGTTTTGCACTAGCACACACAGCATCTATAGCATTGTTGGTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026264 Nonsense 997 1761 23 40
Genomic Location (Zv9):
Chromosome 17 (position 16106061)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16256889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTAACACAGGGATTTTGTGTGTCTTTGTTTCTCAGGGTCAGTCTCGG[C/T]GAGTTCAGGTGGAGGTGCGTTCAGTTCAAGATTCGGGCACAATGCCATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link