fbn2a

Ensembl ID:
ENSDARG00000079729
ZFIN ID:
ZDB-GENE-090112-4
Description:
Fibrillin 4 [Source:UniProtKB/TrEMBL;Acc:B6D7H3]
Human Orthologue:
FBN3
Human Description:
fibrillin 3 [Source:HGNC Symbol;Acc:18794]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41616 Nonsense Mutation detected in F1 DNA During 2016
sa34874 Nonsense Mutation detected in F1 DNA During 2016
sa41617 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130144 Nonsense 55 717 3 17
Genomic Location (Zv9):
Chromosome 10 (position 16818829)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16315524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTCAGATGTAAACGAGTGTTCGGAGGAGCCTGGGATCTGCACATA[T/A]GGGACCTGCTTCAACAGTCTGGGCAGCTTTGAGTGTGTGTGTAAACCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130144 Nonsense 262 717 8 17
Genomic Location (Zv9):
Chromosome 10 (position 16828435)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16325130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATCCTCTGCTCTGTGCATTTCGCTGCATCAACACTTTCGGGAGTTAT[G/T]AATGCAGCTGTCCATCTGGTTACACACTGAGAGAGGATGGACGCATGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130144 Essential Splice Site 279 717 8 17
Genomic Location (Zv9):
Chromosome 10 (position 16828490)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16325185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGTCCATCTGGTTACACACTGAGAGAGGATGGACGCATGTGTCAAG[G/A]TATGAAATATCATTAATAATCAATGATTTTAACAATATAACTTTTCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link