fbn2a

Ensembl ID:
ENSDARG00000079729
ZFIN ID:
ZDB-GENE-090112-4
Description:
Fibrillin 4 [Source:UniProtKB/TrEMBL;Acc:B6D7H3]
Human Orthologue:
FBN3
Human Description:
fibrillin 3 [Source:HGNC Symbol;Acc:18794]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3755 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130144 Nonsense 291 717 9 17
Genomic Location:
Chromosome 10 (position 16829828)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCTTTATRTACAGATGTGGACGAGTGTGCAGAAGATCTTCATAACTG[T/A]GACTCCAGAGGAATGGAATGTAGCAACCTAATTGGCACATTTATGTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qx2yt64m