si:ch211-194i4.1

Ensembl ID:
ENSDARG00000079725
ZFIN ID:
ZDB-GENE-070912-171
Description:
Novel protein similar to vertebrate DEAH (Asp-Glu-Ala-His) box polypeptide 9 (DHX9) [Source:UniProtK
Human Orthologue:
DHX9
Human Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 9 [Source:HGNC Symbol;Acc:2750]
Mouse Orthologue:
Dhx9
Mouse Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 9 Gene [Source:MGI Symbol;Acc:MGI:108177]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19813 Nonsense Available for shipment Available now
sa32962 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13148 Nonsense Available for shipment Available now
sa39873 Nonsense Mutation detected in F1 DNA During 2017
sa8582 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39874 Essential Splice Site Mutation detected in F1 DNA During 2017
sa18641 Essential Splice Site Available for shipment Available now
sa39875 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111661 Nonsense 109 1271 3 27
ENSDART00000134918 Nonsense 109 1271 4 28
Genomic Location (Zv9):
Chromosome 2 (position 35576389)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35873099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGAGGTAATGATGATGGTGGCGGATTTGGAAATCTCCCGTCTAACTG[T/A]CCACTGCCTCCACATCTGGCTGTGAAGAAGGAGTTAGGTGAGAGAATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111661 Essential Splice Site 121 1271 3 27
ENSDART00000134918 Essential Splice Site 121 1271 4 28
Genomic Location (Zv9):
Chromosome 2 (position 35576427)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35873137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGTCTAACTGTCCACTGCCTCCACATCTGGCTGTGAAGAAGGAGTTAG[G/A]TGAGAGAATGGCTGAAAGTGCTGGTTCACCCTAAAAGGGAAATCTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111661 Nonsense 168 1271 5 27
ENSDART00000134918 Nonsense 168 1271 6 28
Genomic Location (Zv9):
Chromosome 2 (position 35577809)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35874519
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTAAGTTTCTGAGAATGAATTKTTCTTTTTWTAATACCSAAAAGACRTA[T/G]GAATCAGAGGAAGTTGATCTGAATGCTGGCCTGCATGGGAACTGGACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39873
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111661 Nonsense 294 1271 8 27
ENSDART00000134918 Nonsense 294 1271 9 28
Genomic Location (Zv9):
Chromosome 2 (position 35579485)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35876195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGATGTTTATCCAGTTAATGTCAATGATGATGTCCAACACCAGCTGTA[C/A]AGTGTTGTGCAGGAACTTGGCATCCACATCCCTCCTCCTGTAAGTGTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111661 Essential Splice Site 361 1271 9 27
ENSDART00000134918 Essential Splice Site 361 1271 10 28
Genomic Location (Zv9):
Chromosome 2 (position 35579767)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35876477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAACCCTTGGACCAGCTCCAACATTGACGAAGGACCACTAGCATTTG[T/C]GAGTYTGCTTTTCTGCATCGAKCTTTTCAATTGGTGTTTGCAAGCAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111661 Essential Splice Site 387 1271 10 27
ENSDART00000134918 Essential Splice Site 387 1271 11 28
Genomic Location (Zv9):
Chromosome 2 (position 35579951)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35876661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGAATGAGCTCAACTATCAGCTTGAACAGGACCAAAATCTGCAGACG[G/T]TGAGATAAAAATGCCACTTTAAGACTCCATGAAATCAAATAGAAAATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18641
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111661 Essential Splice Site 790 1271 19 27
ENSDART00000134918 Essential Splice Site 790 1271 20 28
Genomic Location (Zv9):
Chromosome 2 (position 35587194)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35883904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGACCAGGCTTCTGCTTTCACCTGTGCAGTCGGGCTCGTTTTGAAAAG[T/C]ATGAAATCTCATTCTTYRTCTTAGTCTCCAAGTCAAACAGTATATGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111661 Essential Splice Site 844 1271 20 27
ENSDART00000134918 Essential Splice Site 844 1271 21 28
Genomic Location (Zv9):
Chromosome 2 (position 35587432)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35884142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCCACCACCATTGGATGCCGTTATTGAGGCTGAACATACTCTGAGAGG[T/G]AGAACTTCTGCTGCTTTTTTTTTTTTTCATACCAGTGATGTTCAGGTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link