NP_001082801.1

Ensembl ID:
ENSDARG00000079721
Description:
hypothetical protein LOC325787 [Source:RefSeq peptide;Acc:NP_001082801]
Human Orthologue:
ZC3H7B
Human Description:
zinc finger CCCH-type containing 7B [Source:HGNC Symbol;Acc:30869]
Mouse Orthologue:
Zc3h7b
Mouse Description:
zinc finger CCCH type containing 7B Gene [Source:MGI Symbol;Acc:MGI:1328310]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25981 Nonsense Mutation detected in F1 DNA During 2017
sa5725 Nonsense F2 line generated During 2017
sa2113 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa25981
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111562 Nonsense 6 952 2 25
Genomic Location (Zv9):
Chromosome 3 (position 5059738)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4582839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTTTGTTTTTCAGCTGTGTGATGGTCAAACATGAGCGCTGAGCGG[C/T]AGAAACGGCAGGAGAAGATTCGGAGAGCGCTGAGCTTCATCAAGTATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5725
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111562 Nonsense 715 952 19 25
ENSDART00000111562 Nonsense 715 952 19 25
Genomic Location (Zv9):
Chromosome 3 (position 5030637)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4553738
KASP Assay ID:
554-3096.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGAACACTCNNGACCCCTCTCACTCTCTCCACCTTTCTCTCTTCAGCT[G/A]GACCAAAGMGAGGAGGGTTTTACTGGTCAAGTCTCACGAGAGGAAGAART
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2113
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111562 Nonsense 715 952 19 25
ENSDART00000111562 Nonsense 715 952 19 25
Genomic Location (Zv9):
Chromosome 3 (position 5030637)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4553738
KASP Assay ID:
554-3096.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGAACACTCNNGACCCCTCTCACTCTCTCCACCTTTCTCTCTTCAGCT[G/A]GACCAAAGAGAGGAGGGTTTTACTGGTCAAGTCTCACGAGAGGAAGAART
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link