GAL3ST4

Ensembl ID:
ENSDARG00000079712
Description:
galactose-3-O-sulfotransferase 4 [Source:HGNC Symbol;Acc:24145]
Human Orthologue:
GAL3ST4
Human Description:
galactose-3-O-sulfotransferase 4 [Source:HGNC Symbol;Acc:24145]
Mouse Orthologue:
Gal3st4
Mouse Description:
galactose-3-O-sulfotransferase 4 Gene [Source:MGI Symbol;Acc:MGI:1916254]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20945 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20945
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111494 Nonsense 201 475 4 4
Genomic Location:
Chromosome 7 (position 27524618)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCGTGCCAAAGGACTGGGTGATTTTGCTGACAACCCCTACAAGTACTA[T/A]GACCCAAGGCTCCGCAATAACCATTATGCCCGCAACCTGATGTGGTTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mczweyrs