si:ch211-152p11.4

Ensembl ID:
ENSDARG00000079705
ZFIN ID:
ZDB-GENE-060503-764
Description:
Novel protein similar to vertebrate regulator of G-protein signalling family [Source:UniProtKB/TrEMB
Human Orthologue:
RGS1
Human Description:
regulator of G-protein signaling 1 [Source:HGNC Symbol;Acc:9991]
Mouse Orthologue:
Rgs1
Mouse Description:
regulator of G-protein signaling 1 Gene [Source:MGI Symbol;Acc:MGI:1354694]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25092 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36856 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25092
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114301 Essential Splice Site 167 322 3 6
ENSDART00000136414 Essential Splice Site 167 322 4 7
Genomic Location (Zv9):
Chromosome 19 (position 28023960)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27954072
KASP Assay ID:
554-7667.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATTCCTCGCATACGAATTTGAAAGAGCACCGAGAGAATGTAACCAGG[T/C]AAAAGACATCACCTCCGCAAATAATCAAATCACATTTTTGCACTCTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114301 Essential Splice Site 210 322 4 6
ENSDART00000136414 Essential Splice Site 210 322 5 7
Genomic Location (Zv9):
Chromosome 19 (position 28023646)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27953758
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGTGGAGAGCTGGGCCAAGTGCCTTGAAACTTTGCTGGCCAGCAGAG[G/A]TGAGCACTCCTTTATAAACTGCTTGAGTCGCCAGGCAGCTGGTCAAAGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link