si:dkey-18p12.4

Ensembl ID:
ENSDARG00000079703
ZFIN ID:
ZDB-GENE-070912-408
Description:
hypothetical protein LOC794946 [Source:RefSeq peptide;Acc:NP_001116179]
Human Orthologues:
CTD-2611O12.2, CTD-2611O12.3, ERMAP, RFPL1, RFPL2, RFPL3, RFPL4A, RFPL4B
Human Descriptions:
erythroblast membrane-associated protein (Scianna blood group) [Source:HGNC Symbol;Acc:15743]
ret finger protein-like 1 [Source:HGNC Symbol;Acc:9977]
ret finger protein-like 2 [Source:HGNC Symbol;Acc:9979]
ret finger protein-like 3 [Source:HGNC Symbol;Acc:9980]
ret finger protein-like 4A [Source:HGNC Symbol;Acc:16449]
ret finger protein-like 4B [Source:HGNC Symbol;Acc:33264]
Mouse Orthologues:
Ermap, Rfpl4
Mouse Descriptions:
erythroblast membrane-associated protein Gene [Source:MGI Symbol;Acc:MGI:1349816]
ret finger protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:2149590]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34673 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112827 Nonsense 299 435 11 11

The following transcripts of ENSDARG00000079703 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 31425395)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30581341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGTCTAAAAAATATACCGGTCTCGATAACTGGGAAGGATTTCAAAGG[A/T]AGAAATGTAGGTTTGATGGCTGGGCGTGTGTTCAAGCTAAAGAGGGTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link