LOC100333062

Ensembl ID:
ENSDARG00000079702
Human Orthologue:
WDR81
Human Description:
WD repeat domain 81 [Source:HGNC Symbol;Acc:26600]
Mouse Orthologue:
Wdr81
Mouse Description:
WD repeat domain 81 Gene [Source:MGI Symbol;Acc:MGI:2681828]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39050 Nonsense Mutation detected in F1 DNA During 2016
sa22655 Nonsense Available for shipment Available now
sa35894 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22654 Nonsense Available for shipment Available now
sa22653 Nonsense Available for shipment Available now
sa11031 Essential Splice Site Available for shipment Available now
sa14473 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111927 Nonsense 40 2065 1 11
Genomic Location (Zv9):
Chromosome 15 (position 25904501)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26635284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGACCCAATGAGTTGGTGGTCCTGGTTCCAACCCGCTGGGTAATGGCCT[T/A]GAGAAACAAGAGAGTTACTCGCTGTGCAAAATATGAGAGCTTCAGTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22655
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111927 Nonsense 83 2065 1 11
Genomic Location (Zv9):
Chromosome 15 (position 25904373)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26635156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAATGAAACTGCCATCTGGCTGGACACGTGTTTGCATCCAAGGTCTT[C/T]GAAAGCGTAAACTCGGATACCGTTTCGCCAGGGAAACTGGCTGCCATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111927 Essential Splice Site 120 2065 2 11
Genomic Location (Zv9):
Chromosome 15 (position 25903814)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26634597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACTATTAATAAATAAATTTAATTATTTATTTATTTGTTTGTATTCCC[A/C]GAAATCTGTGGCATGAAGCGTACATGACTCATGTGCAGCCATATGCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22654
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111927 Nonsense 277 2065 2 11
Genomic Location (Zv9):
Chromosome 15 (position 25903343)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26634126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGCTGTTGTGTGGTGAACTCTCCTTACTTGATATTGCAGTTGATGAG[C/T]AGCTCTGTAGTCGCCTAAAGATCTCACTTGCACACTATGAAAAGTTTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22653
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111927 Nonsense 1516 2065 7 11
Genomic Location (Zv9):
Chromosome 15 (position 25898340)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26629123
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAACAACATTATTTAATAATATTAAATCCTTTTCTTTTGGTGCAGATT[G/T]GAAGTGCCCCACGTAGGGAGGTTGCAGAGTGCACATACCTGGACTTGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11031
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111927 Essential Splice Site 1570 2065 8 11
Genomic Location (Zv9):
Chromosome 15 (position 25898098)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26628881
KASP Assay ID:
554-6794.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAACACATTTTATAAATATCTGTTWAAMATCTTTTGTTTTGTTTTTT[A/C]GGTGATTCAGGAATTCGCAAACTTGTTACAAATCATGAGCTAGTTTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14473
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111927 Essential Splice Site 1570 2065 8 11
Genomic Location (Zv9):
Chromosome 15 (position 25898098)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 26628881
KASP Assay ID:
554-6794.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAACACATTTTATAAATATCTGTTWAAMATCTTTTGTTTTGTTTTTT[A/C]GGTGATTCAGGAATTCGCAAACTTGTTACAAATCATGAGCTAGTTTGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link