LOC100333062

Ensembl ID:
ENSDARG00000079702
Human Orthologue:
WDR81
Human Description:
WD repeat domain 81 [Source:HGNC Symbol;Acc:26600]
Mouse Orthologue:
Wdr81
Mouse Description:
WD repeat domain 81 Gene [Source:MGI Symbol;Acc:MGI:2681828]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22655 Nonsense Mutation detected in F1 DNA During 2014
sa22654 Nonsense Mutation detected in F1 DNA During 2014
sa22653 Nonsense Mutation detected in F1 DNA During 2014
sa11031 Essential Splice Site Available for shipment Available now
sa14473 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111927 Nonsense 83 2065 1 11
Genomic Location:
Chromosome 15 (position 25904373)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAATGAAACTGCCATCTGGCTGGACACGTGTTTGCATCCAAGGTCTT[C/T]GAAAGCGTAAACTCGGATACCGTTTCGCCAGGGAAACTGGCTGCCATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22654
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111927 Nonsense 277 2065 2 11
Genomic Location:
Chromosome 15 (position 25903343)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGCTGTTGTGTGGTGAACTCTCCTTACTTGATATTGCAGTTGATGAG[C/T]AGCTCTGTAGTCGCCTAAAGATCTCACTTGCACACTATGAAAAGTTTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111927 Nonsense 1516 2065 7 11
Genomic Location:
Chromosome 15 (position 25898340)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAACAACATTATTTAATAATATTAAATCCTTTTCTTTTGGTGCAGATT[G/T]GAAGTGCCCCACGTAGGGAGGTTGCAGAGTGCACATACCTGGACTTGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11031
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111927 Essential Splice Site 1570 2065 8 11
Genomic Location:
Chromosome 15 (position 25898098)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAACACATTTTATAAATATCTGTTWAAMATCTTTTGTTTTGTTTTTT[A/C]GGTGATTCAGGAATTCGCAAACTTGTTACAAATCATGAGCTAGTTTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14473
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111927 Essential Splice Site 1570 2065 8 11
Genomic Location:
Chromosome 15 (position 25898098)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAACACATTTTATAAATATCTGTTWAAMATCTTTTGTTTTGTTTTTT[A/C]GGTGATTCAGGAATTCGCAAACTTGTTACAAATCATGAGCTAGTTTGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4beh67b5