LOC559521

Ensembl ID:
ENSDARG00000079700
Human Orthologue:
B3GALT1
Human Description:
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1 [Source:HGNC Symbol;Acc:916]
Mouse Orthologue:
B3galt1
Mouse Description:
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:134

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40638 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113730 Nonsense 164 328 1 1
Genomic Location (Zv9):
Chromosome 6 (position 10051703)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 9905510
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGATTCCTATCACAATTTGACTCTGAAGACTCTCATGGGAATGCGATG[G/A]GTGTCTTTGTTTTGCCCCAACGCGCAGTACGTCATGAAAACCGACAGTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link