NR_023338.1

Ensembl ID:
ENSDARG00000079688
Description:
wu:fc10d10 (wu:fc10d10), non-coding RNA [Source:RefSeq DNA;Acc:NR_023338]
Human Orthologue:
TNRC6A
Human Description:
trinucleotide repeat containing 6A [Source:HGNC Symbol;Acc:11969]
Mouse Orthologue:
Tnrc6a
Mouse Description:
trinucleotide repeat containing 6a Gene [Source:MGI Symbol;Acc:MGI:2385292]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1142 Nonsense Available for shipment Available now
sa20074 Nonsense Available for shipment Available now
sa1542 Nonsense F2 line generated During 2017
sa15745 Nonsense Available for shipment Available now
sa2112 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa1142
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113219 Nonsense 146 1707 2 18
Genomic Location (Zv9):
Chromosome 3 (position 35599354)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35384550
KASP Assay ID:
554-1053.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTAAGCACATGTCAAGGCTCCGGGGAGGGCCCCAGCGGCAAGCTGGCA[G/T]AAAGCAGCCATGGCAAAATAAATGCATGGGGTACCCAAGGTTCCTCAACC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa20074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113219 Nonsense 437 1707 2 18
Genomic Location (Zv9):
Chromosome 3 (position 35600229)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35385425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCCTCATCCTCTTCAAACACTGGCACTAAGGTCTCAAACGGGGAGTG[G/A]AACACTTTGCCCAGCAACAGTCAGCATTCCAATGATAGCACGAACGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1542
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113219 Nonsense 858 1707 2 18
Genomic Location (Zv9):
Chromosome 3 (position 35601490)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35386686
KASP Assay ID:
554-1485.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGTGGAACAAGAACACTGCTGGAGAACAGGATGGCATGTCTGTATCT[C/T]AACCCCCACAAGCCCAAAGCTCCATGGCTCCAAAAGAAAAGAACTGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113219 Nonsense 1378 1707 13 18
Genomic Location (Zv9):
Chromosome 3 (position 35609060)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35394256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTATGTTSATTTGGCAGAGTTCCGTCCTGGTGAGCCCTGGAAAGGATA[T/A]CCAAACATTGATCCTGAAACTGACCCATTTGTCACTCCTGGCAGTGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2112
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113219 Essential Splice Site 1543 1707 16 18
Genomic Location (Zv9):
Chromosome 3 (position 35610732)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35395928
KASP Assay ID:
554-3081.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTCAGGGAGAACTAATTGGCTCGTTCTCAAAAACCTCACACCTCAGG[T/C]AAGACATTTAATGATTTGGGTTGTGCAAACTCACTCTGACAGGTCATAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link