rnf10

Ensembl ID:
ENSDARG00000079687
ZFIN ID:
ZDB-GENE-030131-2969
Description:
RING finger protein 10 [Source:RefSeq peptide;Acc:NP_001116727]
Human Orthologue:
RNF10
Human Description:
ring finger protein 10 [Source:HGNC Symbol;Acc:10055]
Mouse Orthologue:
Rnf10
Mouse Description:
ring finger protein 10 Gene [Source:MGI Symbol;Acc:MGI:1859162]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18120 Nonsense Available for shipment Available now
sa18452 Essential Splice Site Available for shipment Available now
sa14731 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18120
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108518 Nonsense 403 778 8 17
ENSDART00000133124 None None 156 None 5
Genomic Location:
Chromosome 8 (position 43305283)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAGGTTCTGTTGATGGGGTGGACATGAGGAAACTCTCTCTGTCTGAA[C/T]AATCCTCTCCAGAGGTGACTGTGGTCAATAACCTCACAAACTCGAAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108518 Essential Splice Site 568 778 11 17
ENSDART00000133124 None None 156 None 5
Genomic Location:
Chromosome 8 (position 43303669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCTTCAGCCACCCATTCTCTCGAAAGAAACATTGGACAGTTTTGCAG[G/A]TACATCAGTGTAAAAGCATCTGCTGTATTAYGCACYATAAGATACATGAS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14731
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108518 Nonsense 735 778 16 17
ENSDART00000133124 Nonsense 113 156 4 5
Genomic Location:
Chromosome 8 (position 43301784)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGGGTCCCTGTACCCAGTTTCCAGAACTCCTTYAGTCAGGCTCTGGGA[C/T]AGGCTCTATCAAAGCTGGACAATGGAAATCAAACCCCAGCCCCAGCTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u9xhd8ka