LOC568741

Ensembl ID:
ENSDARG00000079672
Human Orthologues:
AC103965.1, EFTUD1
Human Descriptions:
elongation factor Tu GTP binding domain containing 1 [Source:HGNC Symbol;Acc:25789]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A6NKW7]
Mouse Orthologue:
Eftud1
Mouse Description:
elongation factor Tu GTP binding domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2141969]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30883 Nonsense Mutation detected in F1 DNA During 2015
sa20868 Essential Splice Site Available for shipment Available now
sa12887 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa30883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113905 Nonsense 82 1133 4 21
Genomic Location:
Chromosome 7 (position 13183370)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGTCATTGCTCCTGTAGCTGAGATATCTGGACAGCAGGGAGGATGAG[C/T]AGATCAGAGGAATCACCATGAAGTCCAGCGCTATTTCATTACATTTCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113905 Essential Splice Site 502 1133 13 21
Genomic Location:
Chromosome 7 (position 13129014)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCAGGAGGAGATTCAATCCCAGCCCCAGCCGCAGCAGGTGTCACAGG[C/A]AAGAATAAGACCTTTTTAATGATCAGTGTGTGAAATTGAGTGAGGAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12887
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113905 Essential Splice Site 1010 1133 19 21
Genomic Location:
Chromosome 7 (position 12999897)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYGGCTGCGATGTACACCTGCGAGATCATGGCCACGGCTGAGGTCCTGGG[T/A]AAGCTGASTTTATTCACRTTTCTTTGATTAAAAGACYGCMTTGGATTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yidu4vh2