LOC568741

Ensembl ID:
ENSDARG00000079672
Human Orthologues:
AC103965.1, EFTUD1
Human Descriptions:
elongation factor Tu GTP binding domain containing 1 [Source:HGNC Symbol;Acc:25789]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A6NKW7]
Mouse Orthologue:
Eftud1
Mouse Description:
elongation factor Tu GTP binding domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2141969]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20868 Essential Splice Site Available for shipment Available now
sa12887 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113905 Essential Splice Site 502 1133 13 21
Genomic Location:
Chromosome 7 (position 13129014)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCAGGAGGAGATTCAATCCCAGCCCCAGCCGCAGCAGGTGTCACAGG[C/A]AAGAATAAGACCTTTTTAATGATCAGTGTGTGAAATTGAGTGAGGAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12887
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113905 Essential Splice Site 1010 1133 19 21
Genomic Location:
Chromosome 7 (position 12999897)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYGGCTGCGATGTACACCTGCGAGATCATGGCCACGGCTGAGGTCCTGGG[T/A]AAGCTGASTTTATTCACRTTTCTTTGATTAAAAGACYGCMTTGGATTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yidu4vh2