si:dkey-108c13.1

Ensembl ID:
ENSDARG00000079671
ZFIN ID:
ZDB-GENE-070705-280
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WV09]
Human Orthologue:
RP4-788L13.1
Human Description:
Lipid phosphate phosphatase-related protein type 4 [Source:UniProtKB/Swiss-Prot;Acc:Q7Z2D5]
Mouse Orthologue:
D3Bwg0562e
Mouse Description:
DNA segment, Chr 3, Brigham & Women's Genetics 0562 expressed Gene [Source:MGI Symbol;Acc:MGI:106530

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7490 Missense Mutation detected in F1 DNA During 2017
sa13790 Essential Splice Site Available for shipment Available now
sa31271 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7490
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112131 Missense 126 775 3 7
ENSDART00000144624 Missense 126 765 3 7
Genomic Location (Zv9):
Chromosome 2 (position 18871732)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20700463
KASP Assay ID:
554-4006.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGGCTAACATAAATGCTGCTGGCTGCAATTTCAACTCTTACATCCGA[C/T]GGGCTGTGAGGTTTGTTGGTGGGTGTATATTTTTCCTGCACTTGTGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13790
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112131 Essential Splice Site 275 775 7 7
ENSDART00000144624 Essential Splice Site 275 765 7 7
Genomic Location (Zv9):
Chromosome 2 (position 18880951)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20709682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTGCTCACTATCCTTACCAAGAGATTTCWGCCTTTTGCACTACTTTA[G/A]GGTCTGTATGCAGTTGGGAACTTTAAACCTAGTGAAGACACATCTCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31271
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112131 Nonsense 710 775 7 7
ENSDART00000144624 Nonsense 710 765 7 7
Genomic Location (Zv9):
Chromosome 2 (position 18882257)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20710988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATCCCCACTTCCATCATCACCACCACCAACAGAGTATCACCACTATT[C/T]GAGTCACACCAGTGGAAGTCAGCAGTGAAGCCACCTCGGAGACTCTCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link