LRRC7

Ensembl ID:
ENSDARG00000079670
Description:
leucine rich repeat containing 7 [Source:HGNC Symbol;Acc:18531]
Human Orthologue:
LRRC7
Human Description:
leucine rich repeat containing 7 [Source:HGNC Symbol;Acc:18531]
Mouse Orthologue:
Lrrc7
Mouse Description:
leucine rich repeat containing 7 Gene [Source:MGI Symbol;Acc:MGI:2676665]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16585 Nonsense Available for shipment Available now
sa10855 Essential Splice Site Available for shipment Available now
sa20720 Nonsense Mutation detected in F1 DNA During 2014
sa20719 Nonsense Mutation detected in F1 DNA During 2014
sa17609 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113924 Nonsense 15 1547 1 27
Genomic Location:
Chromosome 6 (position 29924132)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTGGAGATGACGACTAAGAGGAAGATCATCGGCCGCCTGGTGCCCTGT[C/T]GATGTTTCCGGGGGGAGGAGGAGGTCATCTCAGTTCTGGATTATTCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10855
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113924 Essential Splice Site 199 1547 6 27
Genomic Location:
Chromosome 6 (position 29903793)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCGCAACTGGAGCGGTTAGACTTGGGAAGCAATGAATTCTCTGAACTGG[T/A]RAGAAAGATGCTCTCCTGTTGAAGGCTTTTTATCAATGGGACAGCTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113924 Nonsense 629 1547 19 27
Genomic Location:
Chromosome 6 (position 29865862)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGACACTTATGTTTCCAGGACTCCATGGGAGGCTCCCCAAATGATATC[C/T]GAATCTCTGACATGAGACCAACTTTGGTAGAGCCACCAATGTACAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20719
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113924 Nonsense 822 1547 21 27
Genomic Location:
Chromosome 6 (position 29862388)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGACAAGACCGCATCGTTGGAGTTCCCCTAGAGCTCGATCAGACACAA[C/T]AAACTTTCCACACAGTTCGCAACACCCCTGACACTGAAGTGCCTGCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113924 Essential Splice Site 1287 1547 21 27
Genomic Location:
Chromosome 6 (position 29860990)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGGAGACAGCAGCTGCTTAGACAYATAGAAGCGAAGAGACTAGACCGG[G/T]TGAGTAAGRAAGTTTTGCTTTATTTTTTNATACAACRRAGTTTGTTAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n41klram