LRRC7

Ensembl ID:
ENSDARG00000079670
Description:
leucine rich repeat containing 7 [Source:HGNC Symbol;Acc:18531]
Human Orthologue:
LRRC7
Human Description:
leucine rich repeat containing 7 [Source:HGNC Symbol;Acc:18531]
Mouse Orthologue:
Lrrc7
Mouse Description:
leucine rich repeat containing 7 Gene [Source:MGI Symbol;Acc:MGI:2676665]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16585 Nonsense Available for shipment Available now
sa33883 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40711 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10855 Essential Splice Site Available for shipment Available now
sa20720 Nonsense Available for shipment Available now
sa20719 Nonsense Available for shipment Available now
sa17609 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113924 Nonsense 15 1547 1 27
Genomic Location (Zv9):
Chromosome 6 (position 29924132)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30219775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTGGAGATGACGACTAAGAGGAAGATCATCGGCCGCCTGGTGCCCTGT[C/T]GATGTTTCCGGGGGGAGGAGGAGGTCATCTCAGTTCTGGATTATTCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113924 Essential Splice Site 64 1547 2 27
Genomic Location (Zv9):
Chromosome 6 (position 29915763)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30211406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGAACACATTTTAACCAAATCTTTGTATTTCTGTTTTCTTTTTTTCA[G/T]CAACTCTTCAACTGTCAAGCGCTCAAGAAGCTGAGCATGCCTGACAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113924 Essential Splice Site 159 1547 4 27
Genomic Location (Zv9):
Chromosome 6 (position 29911915)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30207558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCTTAAATGATGCCTTCCTTGAATACCTGCCTGCCAATTTTGGGAGG[T/C]AAGAGCTTCATCTTGGGGCTCTCTGTTCTTGCGCTGCCGGGGGATTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10855
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113924 Essential Splice Site 199 1547 6 27
Genomic Location (Zv9):
Chromosome 6 (position 29903793)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30199436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCGCAACTGGAGCGGTTAGACTTGGGAAGCAATGAATTCTCTGAACTGG[T/A]RAGAAAGATGCTCTCCTGTTGAAGGCTTTTTATCAATGGGACAGCTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20720
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113924 Nonsense 629 1547 19 27
Genomic Location (Zv9):
Chromosome 6 (position 29865862)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30161505
KASP Assay ID:
2259-7660.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGACACTTATGTTTCCAGGACTCCATGGGAGGCTCCCCAAATGATATC[C/T]GAATCTCTGACATGAGACCAACTTTGGTAGAGCCACCAATGTACAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20719
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113924 Nonsense 822 1547 21 27
Genomic Location (Zv9):
Chromosome 6 (position 29862388)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30158031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGACAAGACCGCATCGTTGGAGTTCCCCTAGAGCTCGATCAGACACAA[C/T]AAACTTTCCACACAGTTCGCAACACCCCTGACACTGAAGTGCCTGCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113924 Essential Splice Site 1287 1547 21 27
Genomic Location (Zv9):
Chromosome 6 (position 29860990)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30156633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGGAGACAGCAGCTGCTTAGACAYATAGAAGCGAAGAGACTAGACCGG[G/T]TGAGTAAGRAAGTTTTGCTTTATTTTTTNATACAACRRAGTTTGTTAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link