LOC568637

Ensembl ID:
ENSDARG00000079665
Human Orthologue:
GPR158
Human Description:
G protein-coupled receptor 158 [Source:HGNC Symbol;Acc:23689]
Mouse Orthologue:
Gpr158
Mouse Description:
G protein-coupled receptor 158 Gene [Source:MGI Symbol;Acc:MGI:2441697]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11487 Nonsense Available for shipment Available now
sa9182 Nonsense Mutation detected in F1 DNA During 2014
sa11073 Nonsense Available for shipment Available now
sa8078 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3396 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113081 Nonsense 59 1286 1 11
Genomic Location:
Chromosome 2 (position 12033826)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGACAAAGATCTCGAAATCAAGGCTAAATATCCTGTTTACAGCACCAGC[G/A]AGACGACGCACCAGCAGCCGACCATCTCCAGCACCGAGCGACCGGCGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9182
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113081 Nonsense 78 1286 1 11
Genomic Location:
Chromosome 2 (position 12033769)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCACCAGCAGCCGACCATCTCCAGCACCGAGCGACCGGCGGTGGCGCAT[A/T]AGCTCGAGGAGGATCTTCCGCGGGTGGTCAYCGCTTTCCTCCACACCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113081 Nonsense 254 1286 1 11
Genomic Location:
Chromosome 2 (position 12033240)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGGCTGGTTAAAARTAGAGCGTTTCCAGCAGCGCATGGCGGATATTTTT[T/A]AGRCAAAAGTCATGTCAAGTGGTCTTCGCCTTATCTAGAGTGCGAGCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113081 Essential Splice Site 437 1286 4 11
Genomic Location:
Chromosome 2 (position 11947061)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGGACTTYATCAGCATGGTKGTCGTCTACCATTTTCGACACAACAAGG[T/C]AGGAATGTTTACTGCCAGTTGTCTTGCCTGGAAAGACTCTKTACTCTRTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113081 Nonsense 1244 1286 11 11
Genomic Location:
Chromosome 2 (position 11899972)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGCAGTAAGCGTACTGAWGTTTGCCCCTGGGAGACAGAGGCACTAT[C/A]AAGTGTTACCTCACATGATAAAGATMCTCCAWCAACTGAAAACCACACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bs3tpqlf