LOC797104

Ensembl ID:
ENSDARG00000079656
Human Orthologue:
FAM171A2
Human Description:
family with sequence similarity 171, member A2 [Source:HGNC Symbol;Acc:30480]
Mouse Orthologue:
Fam171a2
Mouse Description:
family with sequence similarity 171, member A2 Gene [Source:MGI Symbol;Acc:MGI:2448496]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8046 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3268 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa8046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112694 Essential Splice Site 331 849 8 8
Genomic Location:
Chromosome 24 (position 38318421)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCGYAAGATATCTTTTGAAGATTTGCTAAATGTCAGCATYTGTTTTCC[A/T]GACGAAGGTGTCTGAAGCCCCGACGGCAGCAGAAACAGGTTCAAGTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3268
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112694 Nonsense 455 849 8 8
Genomic Location:
Chromosome 24 (position 38318047)
KASP Assay ID:
554-3078.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGCAATCTGGATRGCAATCTTCTACATGAAAACTACGGCCGCAACTA[C/A]AGTTCTGACGACAAGGATCAAGACTATCGCCGCAGACATGTTGTCAATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x34031zy