LOC797104

Ensembl ID:
ENSDARG00000079656
Human Orthologue:
FAM171A2
Human Description:
family with sequence similarity 171, member A2 [Source:HGNC Symbol;Acc:30480]
Mouse Orthologue:
Fam171a2
Mouse Description:
family with sequence similarity 171, member A2 Gene [Source:MGI Symbol;Acc:MGI:2448496]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37946 Nonsense Mutation detected in F1 DNA During 2016
sa8046 Essential Splice Site Mutation detected in F1 DNA During 2016
sa3268 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa37946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112694 Nonsense 208 849 5 8
Genomic Location:
Chromosome 24 (position 38319617)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGAAAATGGCTGGACGGACCTGACAACGATAGCAGCAGTCAGTGCA[C/T]AGTTGTTTGACCGCGAGGGCCGAGCTGTTGAAGTCAGTGAGCCTGTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112694 Essential Splice Site 331 849 8 8
Genomic Location:
Chromosome 24 (position 38318421)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCGYAAGATATCTTTTGAAGATTTGCTAAATGTCAGCATYTGTTTTCC[A/T]GACGAAGGTGTCTGAAGCCCCGACGGCAGCAGAAACAGGTTCAAGTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3268
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112694 Nonsense 455 849 8 8
Genomic Location:
Chromosome 24 (position 38318047)
KASP Assay ID:
554-3078.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGCAATCTGGATRGCAATCTTCTACATGAAAACTACGGCCGCAACTA[C/A]AGTTCTGACGACAAGGATCAAGACTATCGCCGCAGACATGTTGTCAATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link