ENSDARG00000079651

Ensembl ID:
ENSDARG00000079651
Mouse Orthologue:
Afg3l1
Mouse Description:
AFG3(ATPase family gene 3)-like 1 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1928277]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44365 Nonsense Mutation detected in F1 DNA During 2016
sa10560 Essential Splice Site Available for shipment Available now
sa44364 Nonsense Mutation detected in F1 DNA During 2016
sa44363 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa44365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109064 Nonsense 184 751 6 17
Genomic Location (Zv9):
Chromosome 25 (position 38180091)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36581880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATCGGCAGCGTGGACACGTTCGAGAGGAATCTAGAAGCTGCACACTA[T/G]GAGCTGGGCCTGGAGCCGTCACACAGAGCAGCGGTGGTCTACACGTCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109064 Essential Splice Site 470 751 11 17
Genomic Location (Zv9):
Chromosome 25 (position 38176044)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36577833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGACGCCATCGCCAGAAAAATGGCAGCTGCTACACCSGGCTTCACSGG[T/A]GAGCGAGAGGAAAATWACATGCTGTGTGCTAATTATATRTTTGGAGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109064 Nonsense 519 751 13 17
Genomic Location (Zv9):
Chromosome 25 (position 38175457)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36577246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGTCCGTGTTCAGGTCTGGAGAAGAAGACTCAGGTATTACAGCCCACT[G/T]AGAAAAAGACGGTAGCCTATCATGAAGCAGGACATGCTGTTGTGGGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109064 Nonsense 557 751 14 17
Genomic Location (Zv9):
Chromosome 25 (position 38174314)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36576103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTGTGTTTTGCAGGTGTCCATCATTCCTCGAGGGAAGGGACTAGGCTA[T/A]GCGCAGTATCTGCCCAAAGAGCAGTATTTATACACGCGCGAGCAGCTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link