sc:d217

Ensembl ID:
ENSDARG00000079645
ZFIN ID:
ZDB-GENE-080303-15
Description:
hypothetical protein LOC100142642 [Source:RefSeq peptide;Acc:NP_001116091]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa973 Nonsense F2 line generated During 2017
sa29713 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa973
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097198 Nonsense 293 503 6 8
Genomic Location (Zv9):
Chromosome 22 (position 7936280)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 7868541
KASP Assay ID:
554-0878.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTSAAACTCTGAAGCCTRATACTGAAATACAGAGAGATGATGAGATA[C/T]AGTGGCTSTTWGGAAATAAAAATGATCTGATTGCTAAAATGACTGGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29713
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097198 Nonsense 475 503 8 8
Genomic Location (Zv9):
Chromosome 22 (position 7935081)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 7867342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTCTCTTATTAATATCCATCTTTGTTTTAGCTCCCGCAGAAAACCAA[G/T]AGCCTGCTTTATTGCCTGAAGAACAGAAACTATTACCTAGAGATTTTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link