pcdh2g16

Ensembl ID:
ENSDARG00000079640
ZFIN ID:
ZDB-GENE-050610-6
Description:
protocadherin 2 gamma 16 [Source:RefSeq peptide;Acc:NP_001019359]
Human Orthologues:
PCDHB1, PCDHG@, PCDHGA1, PCDHGA10, PCDHGA11, PCDHGA12, PCDHGA3, PCDHGA5, PCDHGA6, PCDHGA7, PCDHGA8
Human Descriptions:
protocadherin beta 1 [Source:HGNC Symbol;Acc:8680]
protocadherin gamma cluster [Source:HGNC Symbol;Acc:8695]
protocadherin gamma subfamily A, 1 [Source:HGNC Symbol;Acc:8696]
protocadherin gamma subfamily A, 10 [Source:HGNC Symbol;Acc:8697]
protocadherin gamma subfamily A, 11 [Source:HGNC Symbol;Acc:8698]
protocadherin gamma subfamily A, 12 [Source:HGNC Symbol;Acc:8699]
protocadherin gamma subfamily A, 3 [Source:HGNC Symbol;Acc:8701]
protocadherin gamma subfamily A, 5 [Source:HGNC Symbol;Acc:8703]
protocadherin gamma subfamily A, 6 [Source:HGNC Symbol;Acc:8704]
protocadherin gamma subfamily A, 7 [Source:HGNC Symbol;Acc:8705]
protocadherin gamma subfamily A, 8 [Source:HGNC Symbol;Acc:8706]
Mouse Orthologue:
Pcdhb1
Mouse Description:
protocadherin beta 1 Gene [Source:MGI Symbol;Acc:MGI:2136730]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13119 Nonsense Available for shipment Available now
sa12703 Nonsense Available for shipment Available now
sa14560 Nonsense Available for shipment Available now
sa1346 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13119
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114039 Nonsense 413 804 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2949227)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2084678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTAAGAAATTATTATTCTTTAGTMACAAATGTTATTTTGGATCGCGAG[A/T]AATTGTCWGAGTACAACATCACTGTTRTCGCCACTGATTCCGGAAAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12703
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114039 Nonsense 732 804 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2950186)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2083719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGACAGTCTCGTCTGTTTTACAAGTCCAGTCTTCCGRTTATTCCGTA[T/A]TAWCCGSCGCGTTACGCGGACACTGTTGGAACAGGAAYRCTGCAGCACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114039 Nonsense 733 804 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2950189)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2083716
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACAGTCTCGTCTGTTTTACAAGTCCAGTCTTCCGRTTATTCCGTAWTA[T/A]CCGSCGCGTTACGCGGACACTGTTGGAACAGGAAYRCTGCAGCACGCGYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114039 Nonsense 765 804 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2950285)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2083620
KASP Assay ID:
554-1260.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTAYAATTATGAGGTTTACAGAACAACCGATTCCAGAAAAAGTGACTA[T/A]AAGTTTGTCAGACCTGCAAGTCAAAACGTGTTGATAGTGGATCCTAATTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link