alpk2

Ensembl ID:
ENSDARG00000079637
ZFIN ID:
ZDB-GENE-030131-1868
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8E7H7]
Human Orthologue:
ALPK2
Human Description:
alpha-kinase 2 [Source:HGNC Symbol;Acc:20565]
Mouse Orthologue:
Alpk2
Mouse Description:
alpha-kinase 2 Gene [Source:MGI Symbol;Acc:MGI:2449492]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7949 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110905 Nonsense 1102 1966 2 10
ENSDART00000137858 Nonsense 173 1037 2 10
Genomic Location:
Chromosome 21 (position 9403511)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGAGGAGGAACGTCAAAGCATTTTTACTTCCCCGAGTAGCTCAGCTTA[C/A]ACCAGAGACAAGAATTTAACTGGCTGTGTGAGCAACGAAGAAAGGTGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/owf4hjdk