LOC557376

Ensembl ID:
ENSDARG00000079634
Human Orthologue:
FILIP1
Human Description:
filamin A interacting protein 1 [Source:HGNC Symbol;Acc:21015]
Mouse Orthologue:
Filip1
Mouse Description:
filamin A interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917848]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7475 Missense Mutation detected in F1 DNA During 2014
sa23816 Nonsense Mutation detected in F1 DNA During 2014
sa3067 Nonsense F2 line generated During 2014
sa7474 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7475
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111089 Missense 50 978 1 2
Genomic Location:
Chromosome 20 (position 50040213)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTGAAATCATTTGCYCTGATGCTTGTGGATGAAAGGCAGCTTCACATC[G/A]AACAGATTGACCAGCAGAAACAGAGGGTCCAGGATCTTGGCAAAAAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23816
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111089 Nonsense 347 978 1 2
Genomic Location:
Chromosome 20 (position 50039322)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTCATGGAGGTCACGGAAAAGCTAATTGAGGAAAGTAAGAAGCTTCTT[A/T]AACTGAAGTCCGAAATGGAGATCAAAGTGTCGGCTATTACTAAGGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3067
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111089 Nonsense 512 978 1 2
Genomic Location:
Chromosome 20 (position 50038827)
KASP Assay ID:
554-2848.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGCTGAGGCTRCGCTGCAAGATTGAGGAGGCCAAAACAAGAGATCTC[A/T]AAGCTGACGTAGAGGCACTAAAGGAGAAGATCCACGAGCTTATGAACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7474
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111089 Missense 829 978 1 2
Genomic Location:
Chromosome 20 (position 50037876)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GARCGGTATTCAAGTTGACTCCTGAAAAGCAGACAGTTCCTTCACCCATC[C/T]GCAAATACAACTCTAATATTATAACCACAGAGGACAACAAGATCCATATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v3gsfai4