si:ch211-113e8.10

Ensembl ID:
ENSDARG00000079631
ZFIN ID:
ZDB-GENE-090313-11
Description:
Novel protein similar to H.sapiens ZFP91, zinc finger protein 91 homolog (Mouse) (ZFP91) [Source:Uni
Human Orthologues:
AP001350.3, ZFP91
Human Descriptions:
ZFP91-CNTF readthrough transcript (ZFP91-CNTF), non-coding RNA [Source:RefSeq DNA;Acc:NR_024091]
zinc finger protein 91 homolog (mouse) [Source:HGNC Symbol;Acc:14983]
Mouse Orthologue:
Zfp91
Mouse Description:
zinc finger protein 91 Gene [Source:MGI Symbol;Acc:MGI:104854]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10025 Nonsense Available for shipment Available now
sa17953 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10025
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113527 Nonsense 48 761 1 12
ENSDART00000135647 Nonsense 48 663 1 13
ENSDART00000146917   None 216 None 7
ENSDART00000148234   None 13 None 3
Genomic Location (Zv9):
Chromosome 1 (position 40524883)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39414292
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGCATCCAGAGGACGCGGAGACGGGTGCTTCAACACCGAAGTGACCTG[C/A]CCACCCGAAACCAAYGGAGCCGCGACAAGCGCCACGGGATCAGGAAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17953
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113527 Nonsense 382 761 10 12
ENSDART00000135647 Nonsense 413 663 11 13
ENSDART00000146917 Nonsense 137 216 5 7
ENSDART00000148234   None 13 None 3
Genomic Location (Zv9):
Chromosome 1 (position 40512651)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39402060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTACGTCTGCCCTCACCCCACCTGCGGAAGACTCTTTCGGCTGCAGAAA[C/T]AATTGCTCCGCCATGCCAAGCACCACACAGGTRAGATAGRAACGCTTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link