atr

Ensembl ID:
ENSDARG00000079625
ZFIN ID:
ZDB-GENE-070912-458
Description:
Novel protein similar to vertebrate ataxia telangiectasia and Rad3 related (ATR) [Source:UniProtKB/T
Human Orthologue:
ATR
Human Description:
ataxia telangiectasia and Rad3 related [Source:HGNC Symbol;Acc:882]
Mouse Orthologue:
Atr
Mouse Description:
ataxia telangiectasia and Rad3 related Gene [Source:MGI Symbol;Acc:MGI:108028]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19711 Nonsense Mutation detected in F1 DNA During 2014
sa6829 Nonsense Mutation detected in F1 DNA During 2014
sa14005 Nonsense Available for shipment Available now
sa15319 Essential Splice Site Available for shipment Available now
sa14645 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111604 Nonsense 106 2651 4 48
ENSDART00000144801 None None 2064 None 40
ENSDART00000144988 Nonsense 104 391 4 4

The following transcripts of ENSDARG00000079625 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 16265705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATAACCATCATAGATTGACCGTCTACTTCTCCCTTCCCAGATTTCACT[A/T]AATGGATCATTAATCGCCTCTTACGAATTGCTGCTTGCCCAGAATGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6829
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111604 Nonsense 270 2651 4 48
ENSDART00000144801 None None 2064 None 40
ENSDART00000144988 Nonsense 268 391 4 4

The following transcripts of ENSDARG00000079625 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 16265213)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTTTTAACTCGSATTGTGACTCTAGGAGGCTTCCCCGAAGACCATTCA[C/T]AGCCCTTTTTCTCAGCTTTTTTGCATGTCCTGGACTCATTACCTGCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14005
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111604 Nonsense 475 2651 6 48
ENSDART00000144801 None None 2064 None 40
ENSDART00000144988 None None 391 None 4

The following transcripts of ENSDARG00000079625 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 16263339)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGAGCAGAAGTGAGGTTTGGGCAGCTGTAGACTGTCGTCTGGAGGAGT[T/A]ACTGWCACAGATGAGAAACCATACAGTGAGCCAATGCGTGAGTGCGGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111604 Essential Splice Site 1509 2651 26 48
ENSDART00000144801 Essential Splice Site 922 2064 18 40
ENSDART00000144988 None None 391 None 4

The following transcripts of ENSDARG00000079625 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 16234522)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTTCTCWGACTGGTCTGCAACATGGGYCGGATATCTCATCAGTAAAG[T/C]AAGTGCAAATYCTCACRTTTTCCTGGAGTCTCATATAWACAGAAAAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111604 Essential Splice Site 2594 2651 47 48
ENSDART00000144801 Essential Splice Site 2007 2064 39 40
ENSDART00000144988 None None 391 None 4

The following transcripts of ENSDARG00000079625 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 16208501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCTCAAAGACTCAAGTCAATGAATCTGGAGAGATCCTCAATGARAAG[G/A]TACTTCATCYGTTAATTGCTCAAGGCTGARTGAGGRTCCTTATSTGTRAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t84u3af0