atr

Ensembl ID:
ENSDARG00000079625
ZFIN ID:
ZDB-GENE-070912-458
Description:
Novel protein similar to vertebrate ataxia telangiectasia and Rad3 related (ATR) [Source:UniProtKB/T
Human Orthologue:
ATR
Human Description:
ataxia telangiectasia and Rad3 related [Source:HGNC Symbol;Acc:882]
Mouse Orthologue:
Atr
Mouse Description:
ataxia telangiectasia and Rad3 related Gene [Source:MGI Symbol;Acc:MGI:108028]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39800 Essential Splice Site Mutation detected in F1 DNA During 2016
sa19711 Nonsense Available for shipment Available now
sa6829 Nonsense Mutation detected in F1 DNA During 2016
sa14005 Nonsense Available for shipment Available now
sa32870 Nonsense Mutation detected in F1 DNA During 2016
sa15319 Essential Splice Site Available for shipment Available now
sa32869 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38321 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14645 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39800
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111604 Essential Splice Site 52 2651 2 48
ENSDART00000144801   None 2064 None 40
ENSDART00000144988 Essential Splice Site 50 391 2 4

The following transcripts of ENSDARG00000079625 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16269691)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16780518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATACTTTGTCAGTTCATTGACAGGATATTGACAGATGTTGATGTCGG[T/A]AAGAAACAATAAACTGTATTTTGGGGTTTGTTGAGAATAGTTGTTCTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19711
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111604 Nonsense 106 2651 4 48
ENSDART00000144801   None 2064 None 40
ENSDART00000144988 Nonsense 104 391 4 4

The following transcripts of ENSDARG00000079625 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16265705)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16776532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATAACCATCATAGATTGACCGTCTACTTCTCCCTTCCCAGATTTCACT[A/T]AATGGATCATTAATCGCCTCTTACGAATTGCTGCTTGCCCAGAATGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6829
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111604 Nonsense 270 2651 4 48
ENSDART00000144801   None 2064 None 40
ENSDART00000144988 Nonsense 268 391 4 4

The following transcripts of ENSDARG00000079625 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16265213)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16776040
KASP Assay ID:
554-4624.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTTTTAACTCGSATTGTGACTCTAGGAGGCTTCCCCGAAGACCATTCA[C/T]AGCCCTTTTTCTCAGCTTTTTTGCATGTCCTGGACTCATTACCTGCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14005
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111604 Nonsense 475 2651 6 48
ENSDART00000144801   None 2064 None 40
ENSDART00000144988   None 391 None 4

The following transcripts of ENSDARG00000079625 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16263339)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16774166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGAGCAGAAGTGAGGTTTGGGCAGCTGTAGACTGTCGTCTGGAGGAGT[T/A]ACTGWCACAGATGAGAAACCATACAGTGAGCCAATGCGTGAGTGCGGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111604 Nonsense 1279 2651 21 48
ENSDART00000144801 Nonsense 692 2064 13 40
ENSDART00000144988   None 391 None 4

The following transcripts of ENSDARG00000079625 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16240404)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16751231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCTGACCATCCAGAACTGAAAATCATTCACAAAGTCCTTCAGGATTA[T/A]CGTAAGGTACAACCTAAACAAACCAAATGAAGCATAACAAACGACTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111604 Essential Splice Site 1509 2651 26 48
ENSDART00000144801 Essential Splice Site 922 2064 18 40
ENSDART00000144988   None 391 None 4

The following transcripts of ENSDARG00000079625 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16234522)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16745349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTTCTCWGACTGGTCTGCAACATGGGYCGGATATCTCATCAGTAAAG[T/C]AAGTGCAAATYCTCACRTTTTCCTGGAGTCTCATATAWACAGAAAAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111604 Essential Splice Site 1682 2651 29 48
ENSDART00000144801 Essential Splice Site 1097 2064 21 40
ENSDART00000144988   None 391 None 4

The following transcripts of ENSDARG00000079625 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16230941)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16741768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCCGGGAGAAGAAGCAGAACATCCAGGACCATCTTTCATTCCTACAG[G/A]TCTTACCACTCCACAGCTTTAAAAAAAAAAAACCTGTTTCATGTACAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111604 Essential Splice Site 2036 2651 36 48
ENSDART00000144801 Essential Splice Site 1449 2064 28 40
ENSDART00000144988   None 391 None 4

The following transcripts of ENSDARG00000079625 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16221384)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16732211
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGAGACAGCCAACTTCGAGAGCAATGCGATTATGAAAACCTATAAGG[T/A]ATTTCAGTTAGTCACAAATGAAGTCAAATGTCAGTACTGGAGTCAGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111604 Essential Splice Site 2594 2651 47 48
ENSDART00000144801 Essential Splice Site 2007 2064 39 40
ENSDART00000144988   None 391 None 4

The following transcripts of ENSDARG00000079625 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16208501)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16719328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCTCAAAGACTCAAGTCAATGAATCTGGAGAGATCCTCAATGARAAG[G/A]TACTTCATCYGTTAATTGCTCAAGGCTGARTGAGGRTCCTTATSTGTRAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link