LOC569968

Ensembl ID:
ENSDARG00000079622
Human Orthologue:
FRMD5
Human Description:
FERM domain containing 5 [Source:HGNC Symbol;Acc:28214]
Mouse Orthologue:
Frmd5
Mouse Description:
FERM domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2442557]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11096 Essential Splice Site Available for shipment Available now
sa25366 Nonsense Mutation detected in F1 DNA During 2016
sa31577 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11096
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110409 Essential Splice Site 142 572 5 14
Genomic Location:
Chromosome 7 (position 31487928)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTGCAAAAGTTCAGACGCTGCAACGCTGRCTGCATTCATACTGCAGG[G/A]TAAAAGCAAACCACAGTCACAGGAGCCAYTCTTTACAATATTAGCTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110409 Nonsense 361 572 13 14
Genomic Location:
Chromosome 7 (position 31482883)
KASP Assay ID:
554-7557.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCTGGGATGGTGCCCAGCAGGAGTTGTCCATCCATCACACATGGCCCA[C/T]GACAAAGCAGCGTCCCCCGAACTCGGAGGAGAGCCGTCCATATTTCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110409 Nonsense 455 572 14 14
Genomic Location:
Chromosome 7 (position 31476357)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCATCAGACCCGGCTCAGGTTCGCCACACAAATGGCCCTCGCAACATC[C/T]AAGAGGAAGGAGGAACAGAACAGTGCTCTCAGAACCAAGCCAGACCACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link