sc:d411

Ensembl ID:
ENSDARG00000079611
ZFIN ID:
ZDB-GENE-080303-16
Description:
semaphorin-4C [Source:RefSeq peptide;Acc:NP_001121718]
Human Orthologue:
SEMA4C
Human Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Mouse Orthologue:
Sema4c
Mouse Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33554 Nonsense Mutation detected in F1 DNA During 2017
sa12361 Nonsense Available for shipment Available now
sa30613 Nonsense Mutation detected in F1 DNA During 2017
sa20362 Nonsense Available for shipment Available now
sa20361 Nonsense Available for shipment Available now
sa25291 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33553 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33554
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113037 Nonsense 49 863 2 14
Genomic Location (Zv9):
Chromosome 5 (position 16268797)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14064665
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCAGATGTGCATGACAGTATGGCGAGGTTTCGTGCTGTCGGGGTGTG[G/A]AACTACACCATGTTGACCCTGGCAGAACACGAGAGGGTTTTGTATGTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12361
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113037 Nonsense 126 863 4 14
Genomic Location (Zv9):
Chromosome 5 (position 16264935)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14060803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTTCAACTACATTCGCTTCCTGCAGAGCTACAATCACACGCACCTGTA[T/A]ACATGCGGGACGTACGCCTTCCAGCCYAAAKGCACCTACATTGTGAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113037 Nonsense 188 863 6 14
Genomic Location (Zv9):
Chromosome 5 (position 16258124)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14053992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTAGACAAAGAGTTGTACTCCGCCACCCTCAATAACTTTCTGGGCACC[G/T]AGCCCGTAATCCTGAGGAACCTGGGACAACAGCATTACAGCATGAAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113037 Nonsense 200 863 6 14
Genomic Location (Zv9):
Chromosome 5 (position 16258086)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14053954
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGGGCACCGAGCCCGTAATCCTGAGGAACCTGGGACAACAGCATTA[C/A]AGCATGAAGAGTGAATACCTGCCGGCCTGGCTCAACGGTGAGGATCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20361
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113037 Nonsense 206 863 6 14
Genomic Location (Zv9):
Chromosome 5 (position 16258068)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14053936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAATCCTGAGGAACCTGGGACAACAGCATTACAGCATGAAGAGTGAATA[C/A]CTGCCGGCCTGGCTCAACGGTGAGGATCAAAACACACACATAAGCAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113037 Essential Splice Site 213 863 6 14
Genomic Location (Zv9):
Chromosome 5 (position 16258047)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14053915
KASP Assay ID:
554-7660.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAGCATTACAGCATGAAGAGTGAATACCTGCCGGCCTGGCTCAACGG[T/C]GAGGATCAAAACACACACATAAGCAAAATATACTGTATGTGGTGCTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33553
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113037 Nonsense 367 863 9 14
Genomic Location (Zv9):
Chromosome 5 (position 16242683)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14038551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGTCGTCTCAGCGATGGGGCCGTTACACTGGCACTGTGCCCAGTCCA[C/T]GACCTGGAGCGGTGAGCAGAGCGGCCGTTCAGATGGGAGGCCAGCCGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link