akap9

Ensembl ID:
ENSDARG00000079610
ZFIN ID:
ZDB-GENE-030131-7276
Human Orthologues:
AC104809.3, CEP110, CEP250, CROCC, GOLGA4
Human Descriptions:
centrosomal protein 110kDa [Source:HGNC Symbol;Acc:1858]
centrosomal protein 250kDa [Source:HGNC Symbol;Acc:1859]
ciliary rootlet coiled-coil, rootletin [Source:HGNC Symbol;Acc:21299]
golgin A4 [Source:HGNC Symbol;Acc:4427]
Mouse Orthologues:
Cep110, Cep250, Crocc, Golga4
Mouse Descriptions:
centrosomal protein 110 Gene [Source:MGI Symbol;Acc:MGI:1889576]
centrosomal protein 250 Gene [Source:MGI Symbol;Acc:MGI:108084]
ciliary rootlet coiled-coil, rootletin Gene [Source:MGI Symbol;Acc:MGI:3529431]
golgi autoantigen, golgin subfamily a, 4 Gene [Source:MGI Symbol;Acc:MGI:1859646]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25075 Nonsense Mutation detected in F1 DNA During 2016
sa29112 Nonsense Mutation detected in F1 DNA During 2016
sa43191 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36744 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa25075
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110495 Nonsense 441 2229 5 30
Genomic Location (Zv9):
Chromosome 19 (position 539832)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 561319
KASP Assay ID:
554-7390.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGCAGAAGGTGGAGGAGCTGACGACTGAATGCAATTCTCTGCACCTT[C/T]AATATGAACAACTTCAGGAGGAGACGAGGGATCACGAGGACATGAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110495 Nonsense 477 2229 5 30
Genomic Location (Zv9):
Chromosome 19 (position 539940)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 561427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGCTGACCAATGAATTCAATACTCTACGCCTGCAATATGACCAACTG[C/T]AGGAGGAGACCAGAGATCACGAGAAAATGAAGTTGAAGATGGAGGCGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110495 Essential Splice Site 949 2229 9 30
Genomic Location (Zv9):
Chromosome 19 (position 543685)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 565172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGACAGAGAGATGAGTCTGGCTCTGCTGAAGGATCAGCTAAACCGGG[T/C]GAGTGGATATACACCTATAATCATTATAAAGTACATGCAGATACTCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36744
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110495 Nonsense 1513 2229 17 30
Genomic Location (Zv9):
Chromosome 19 (position 551126)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 572613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTGAACTGAACCACACTAAACTAGAGCTGGAGAGCGCTCTGAACACA[C/T]AACACACACACCTGAGGGAGCTTGACACACTCAGGTAACGCACACGCGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link