akap9

Ensembl ID:
ENSDARG00000079610
ZFIN ID:
ZDB-GENE-030131-7276
Human Orthologues:
AC104809.3, CEP110, CEP250, CROCC, GOLGA4
Human Descriptions:
centrosomal protein 110kDa [Source:HGNC Symbol;Acc:1858]
centrosomal protein 250kDa [Source:HGNC Symbol;Acc:1859]
ciliary rootlet coiled-coil, rootletin [Source:HGNC Symbol;Acc:21299]
golgin A4 [Source:HGNC Symbol;Acc:4427]
Mouse Orthologues:
Cep110, Cep250, Crocc, Golga4
Mouse Descriptions:
centrosomal protein 110 Gene [Source:MGI Symbol;Acc:MGI:1889576]
centrosomal protein 250 Gene [Source:MGI Symbol;Acc:MGI:108084]
ciliary rootlet coiled-coil, rootletin Gene [Source:MGI Symbol;Acc:MGI:3529431]
golgi autoantigen, golgin subfamily a, 4 Gene [Source:MGI Symbol;Acc:MGI:1859646]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25075 Nonsense Mutation detected in F1 DNA During 2014
sa7869 Nonsense Mutation detected in F1 DNA During 2014
sa4774 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25075
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110495 Nonsense 441 2229 5 30
Genomic Location:
Chromosome 19 (position 539832)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGCAGAAGGTGGAGGAGCTGACGACTGAATGCAATTCTCTGCACCTT[C/T]AATATGAACAACTTCAGGAGGAGACGAGGGATCACGAGGACATGAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110495 Nonsense 670 2229 5 30
Genomic Location:
Chromosome 19 (position 540519)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAATCTCAGGGAGAAAGTGGCTGCCGTTTTGGTCAGTCAAGCACAACTG[G/T]AAGCYGTTCAGACGCAAACCAAAGAGCTCCAYGCTGAGGCTATAGTAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110495 Nonsense 780 2229 5 30
Genomic Location:
Chromosome 19 (position 540850)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGAAGGTGAACTTGCTGACGGAGAAGCTSAAGGAGCTGGAGGAGGGCT[T/A]GATTGTCATGCAGAAGGACCAGGAGTTGCAGAAGGAGCTKTTGTGTAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fhg82k5c