prmt5

Ensembl ID:
ENSDARG00000079605
ZFIN ID:
ZDB-GENE-030616-585
Description:
protein arginine N-methyltransferase 5 [Source:RefSeq peptide;Acc:NP_001007184]
Human Orthologue:
PRMT5
Human Description:
protein arginine methyltransferase 5 [Source:HGNC Symbol;Acc:10894]
Mouse Orthologue:
Prmt5
Mouse Description:
protein arginine N-methyltransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1351645]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15882 Nonsense Available for shipment Available now
sa13211 Nonsense Available for shipment Available now
sa38347 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088026 Nonsense 64 631 2 16
Genomic Location (Zv9):
Chromosome 2 (position 38064849)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38379763
KASP Assay ID:
2259-2415.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGGAAAATGAACTGGACCCTGCRAAGTCACGTCCYGGAGCCCAAACA[C/T]GATCTGACCTGCTGCTGTGTGGTAGAGGTGAGATTTTATACAAACTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13211
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088026 Nonsense 364 631 11 16
Genomic Location (Zv9):
Chromosome 2 (position 38051857)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38366771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGTTTTTTACCATTATTTTCAGGGTTTTGATGGTACTTGGTGCAGGT[C/T]GAGGTCCTCTGGTAAATGCCTCACTTCGTGCAGCAAAAYAAGCTAAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088026 Essential Splice Site 560 631 14 16
Genomic Location (Zv9):
Chromosome 2 (position 38048540)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38363454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTCGCTGGGTACTTCGAGGCCACGCTGTATAAAGAAGTCACACTCAG[T/C]AAGTCTCATGTGTTGCATCACACAATGCCAATTTAATGCCTCTTTCAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link