ENSDARG00000079603

Ensembl ID:
ENSDARG00000079603
Human Orthologues:
HTR3A, HTR3B, HTR3C, HTR3D, HTR3E, ZACN
Human Descriptions:
5-hydroxytryptamine (serotonin) receptor 3 family member D [Source:HGNC Symbol;Acc:24004]
5-hydroxytryptamine (serotonin) receptor 3, family member C [Source:HGNC Symbol;Acc:24003]
5-hydroxytryptamine (serotonin) receptor 3, family member E [Source:HGNC Symbol;Acc:24005]
5-hydroxytryptamine (serotonin) receptor 3A [Source:HGNC Symbol;Acc:5297]
5-hydroxytryptamine (serotonin) receptor 3B [Source:HGNC Symbol;Acc:5298]
zinc activated ligand-gated ion channel [Source:HGNC Symbol;Acc:29504]
Mouse Orthologues:
Htr3a, Htr3b
Mouse Descriptions:
5-hydroxytryptamine (serotonin) receptor 3A Gene [Source:MGI Symbol;Acc:MGI:96282]
5-hydroxytryptamine (serotonin) receptor 3B Gene [Source:MGI Symbol;Acc:MGI:1861899]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5234 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109636 Nonsense 132 242 3 6
Genomic Location:
Chromosome 3 (position 58981398)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAATATTACTCAGGATTCCAAGAATCTACTTGCAGCCCAGGGAGAGTG[G/A]GAACTCCTCTTAATCAACACTTCYAAGGCTCATGCGACTGTTCTAGGRGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3hkuy9hw