si:busm1-228j01.5

Ensembl ID:
ENSDARG00000079593
ZFIN ID:
ZDB-GENE-030616-395
Description:
Novel protein similar to MHC class II alpha chain [Source:UniProtKB/TrEMBL;Acc:Q95HJ5]
Human Orthologues:
HLA-DMA, HLA-DMB, HLA-DOA, HLA-DPA1, HLA-DQA1, HLA-DQA2, HLA-DRA, XXbac-BPG181M17.5
Human Descriptions:
major histocompatibility complex, class II, DM alpha [Source:HGNC Symbol;Acc:4934]
major histocompatibility complex, class II, DM beta [Source:HGNC Symbol;Acc:4935]
Major histocompatibility complex, class II, DM beta [Source:UniProtKB/TrEMBL;Acc:A2AAT6]
major histocompatibility complex, class II, DO alpha [Source:HGNC Symbol;Acc:4936]
major histocompatibility complex, class II, DP alpha 1 [Source:HGNC Symbol;Acc:4938]
major histocompatibility complex, class II, DQ alpha 1 [Source:HGNC Symbol;Acc:4942]
major histocompatibility complex, class II, DQ alpha 2 [Source:HGNC Symbol;Acc:4943]
major histocompatibility complex, class II, DR alpha [Source:HGNC Symbol;Acc:4947]
Mouse Orthologues:
H2-Aa, H2-DMa, H2-DMb1, H2-DMb2, H2-Oa
Mouse Descriptions:
histocompatibility 2, class II antigen A, alpha Gene [Source:MGI Symbol;Acc:MGI:95895]
histocompatibility 2, class II, locus DMa Gene [Source:MGI Symbol;Acc:MGI:95921]
histocompatibility 2, class II, locus Mb1 Gene [Source:MGI Symbol;Acc:MGI:95922]
histocompatibility 2, class II, locus Mb2 Gene [Source:MGI Symbol;Acc:MGI:95923]
histocompatibility 2, O region alpha locus Gene [Source:MGI Symbol;Acc:MGI:95924]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6151 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41280 Essential Splice Site Mutation detected in F1 DNA During 2017
sa27256 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6151
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061132 Essential Splice Site 67 240 3 6
Genomic Location (Zv9):
Chromosome 8 (position 45769182)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44374375
KASP Assay ID:
554-3727.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGGAAAAACTAGTTTTCACACYACCTGATATGGTAAACTCCTTTTTAA[A/T]TGCAAATCCTCAATATTCTCTGAATGATCTAAGACTCAATRATGTTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41280
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061132 Essential Splice Site 201 240 5 6
Genomic Location (Zv9):
Chromosome 8 (position 45768512)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44375045
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACATGTAATCGCTTATAAAACACATAAATGTTTGTGTGCGTTGTGTGC[A/T]GATGTGGAGGTACAGCAGCCCAGCATTGGTCCATCTGTGTTCTGTGGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27256
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061132 Nonsense 206 240 5 6
Genomic Location (Zv9):
Chromosome 8 (position 45768496)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44375061
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAACACATAAATGTTTGTGTGCGTTGTGTGCAGATGTGGAGGTACAG[C/T]AGCCCAGCATTGGTCCATCTGTGTTCTGTGGAGTTAGTCTTGCTCTTGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link