gabrb2

Ensembl ID:
ENSDARG00000079586
ZFIN ID:
ZDB-GENE-030131-8196
Description:
gamma-aminobutyric acid A receptor, beta 2 [Source:RefSeq peptide;Acc:NP_001019558]
Human Orthologue:
GABRB2
Human Description:
gamma-aminobutyric acid (GABA) A receptor, beta 2 [Source:HGNC Symbol;Acc:4082]
Mouse Orthologue:
Gabrb2
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, subunit beta 2 Gene [Source:MGI Symbol;Acc:MGI:95620]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35684 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2016
sa12791 Essential Splice Site Available for shipment Available now
sa35685 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114750 Splice Site None 519 None 10
ENSDART00000148259 Essential Splice Site None 436 4 10
Genomic Location (Zv9):
Chromosome 14 (position 23211368)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21911158
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCACGTTTGCTCAAAATTCTGATGTTTTTCCTGATGGTGCTCTTATTTC[C/A]AGGACTACACCCTGACTATGTATTTCCAGCAAGCCTGGCGAGACAAGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12791
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114750 Essential Splice Site 226 519 6 10
ENSDART00000148259 Essential Splice Site 143 436 6 10
Genomic Location (Zv9):
Chromosome 14 (position 23252408)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21952198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCATCGTAGACTATAAACTCATCTCCAAGAACGTGGTCTTCTCCACAGG[T/C]TCAGTTTAATCTCTTTCGTGTGTGTCGTACAGYTGGGACCATGAGTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114750 Essential Splice Site 405 519 9 10
ENSDART00000148259 Essential Splice Site 322 436 9 10
Genomic Location (Zv9):
Chromosome 14 (position 23272587)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21972377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTTTGCGGAGGATGCAGCATTAGGACTAGGCGATCAAAGACTTAAGG[T/C]ACTGAATATTTGACCTGAAGTCAAACAAAAACAAATGCAATGGCTCTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link