gabrb2

Ensembl ID:
ENSDARG00000079586
ZFIN ID:
ZDB-GENE-030131-8196
Description:
gamma-aminobutyric acid A receptor, beta 2 [Source:RefSeq peptide;Acc:NP_001019558]
Human Orthologue:
GABRB2
Human Description:
gamma-aminobutyric acid (GABA) A receptor, beta 2 [Source:HGNC Symbol;Acc:4082]
Mouse Orthologue:
Gabrb2
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, subunit beta 2 Gene [Source:MGI Symbol;Acc:MGI:95620]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12791 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12791
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114750 Essential Splice Site 226 519 6 10
ENSDART00000148259 Essential Splice Site 143 436 6 10
Genomic Location:
Chromosome 14 (position 23252408)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCATCGTAGACTATAAACTCATCTCCAAGAACGTGGTCTTCTCCACAGG[T/C]TCAGTTTAATCTCTTTCGTGTGTGTCGTACAGYTGGGACCATGAGTCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x8tl9pw7