pkn3

Ensembl ID:
ENSDARG00000079585
ZFIN ID:
ZDB-GENE-030131-1902
Human Orthologues:
PKN1, PKN2, PKN3
Human Descriptions:
protein kinase N1 [Source:HGNC Symbol;Acc:9405]
protein kinase N2 [Source:HGNC Symbol;Acc:9406]
protein kinase N3 [Source:HGNC Symbol;Acc:17999]
Mouse Orthologues:
Pkn1, Pkn2, Pkn3
Mouse Descriptions:
protein kinase N1 Gene [Source:MGI Symbol;Acc:MGI:108022]
protein kinase N2 Gene [Source:MGI Symbol;Acc:MGI:109211]
protein kinase N3 Gene [Source:MGI Symbol;Acc:MGI:2388285]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17281 Essential Splice Site Available for shipment Available now
sa44608 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17281
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112546 Essential Splice Site 318 940 7 22
Genomic Location (Zv9):
Chromosome 5 (position 33481032)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31243264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TSTTGTGTATGGCTGTTGGATTGTGWATAATTGTGYRTGCATTTGTTTTC[A/T]GGGCGATTGGAGGTCAGGTTGATGGGTTGTCAGGACCTGCTGGAGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44608
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112546 Nonsense 319 940 7 22
Genomic Location (Zv9):
Chromosome 5 (position 33481028)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTATGGCTGTTGGATTGTGTATAATTGTGCGTGCATTTGTTTTCAGGG[C/T]GATTGGAGGTCAGGTTGATGGGTTGTCAGGACCTGCTGGAGTCAGTTCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link