LOC100000797

Ensembl ID:
ENSDARG00000079581
Human Orthologue:
KIAA1486
Human Description:
KIAA1486 [Source:HGNC Symbol;Acc:29291]
Mouse Orthologue:
9430031J16Rik
Mouse Description:
RIKEN cDNA 9430031J16 gene Gene [Source:MGI Symbol;Acc:MGI:2443135]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42599 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42599
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110003 Nonsense 383 600 3 4
Genomic Location (Zv9):
Chromosome 15 (position 35029141)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35903332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACGTGGGAATTGTGAAACCCGGTGCATCCCCAACTGGCACTGAACCA[C/T]AGCCAGAAGCCCAGCAGCAGGTGTCTGGTAAACACCACCACCACCACCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link