si:dkey-19j7.2

Ensembl ID:
ENSDARG00000079575
ZFIN ID:
ZDB-GENE-030219-193
Description:
Novel protein similar to vertebrate AF4/FMR2 family [Source:UniProtKB/TrEMBL;Acc:B0S769]
Human Orthologue:
AFF3
Human Description:
AF4/FMR2 family, member 3 [Source:HGNC Symbol;Acc:6473]
Mouse Orthologue:
Aff3
Mouse Description:
AF4/FMR2 family, member 3 Gene [Source:MGI Symbol;Acc:MGI:106927]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34619 Missense, Nonsense Mutation detected in F1 DNA During 2017
sa34618 Nonsense Mutation detected in F1 DNA During 2017
sa34617 Nonsense Mutation detected in F1 DNA During 2017
sa13564 Nonsense Available for shipment Available now
sa9758 Nonsense Available for shipment Available now
sa21467 Essential Splice Site Available for shipment Available now
sa34615 Essential Splice Site Available for shipment Available now
sa21466 Essential Splice Site Available for shipment Available now
sa21465 Essential Splice Site Available for shipment Available now
sa21464 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34619
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Nonsense 140 1176 5 15
ENSDART00000131634 Missense 51 181 2 2
ENSDART00000137922 Nonsense 157 1196 6 16
Genomic Location (Zv9):
Chromosome 9 (position 22531312)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21687098
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGACAGATGGCTTGAGAAAGTACCTAAAAAGCATCAGTCCACTGACTA[C/A]AATCCAGGAGGAGGACACAGACAGAGTGCAAAATCTGACTGTGATCGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Nonsense 282 1176 5 15
ENSDART00000131634   None 181 None 2
ENSDART00000137922 Nonsense 299 1196 6 16
Genomic Location (Zv9):
Chromosome 9 (position 22530888)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21686674
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAAGAAAGTCCCAGGCATATTTCACGGCCAACAGTTGCCTCCAATTCA[G/T]GACATCATCCCAAAGTCAGGCCATGGGTGCCTCCGGACCATAACGCTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Nonsense 309 1176 5 15
ENSDART00000131634   None 181 None 2
ENSDART00000137922 Nonsense 326 1196 6 16
Genomic Location (Zv9):
Chromosome 9 (position 22530807)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21686593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCGGACCATAACGCTAACCAGAGAAAAGAGTTAAGAGCCAAAGATTCT[C/T]GATCCAAAGACTCTCAGTCTAAAGACTCCAGACCTGGTCCTCAACATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Nonsense 786 1176 5 15
ENSDART00000131634   None 181 None 2
ENSDART00000137922 Nonsense 803 1196 6 16
Genomic Location (Zv9):
Chromosome 9 (position 22529376)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21685162
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRGGAAAGGCAAAAGAAAAGTCATCAATGAAGCATCTGAACCACTCTGAC[C/T]AACCACCTGGAGATGGCAGAAGTAAAAGAAARGTGAGGGGGGNAAAGAMAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9758
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Nonsense 815 1176 6 15
ENSDART00000131634   None 181 None 2
ENSDART00000137922 Nonsense 832 1196 7 16
Genomic Location (Zv9):
Chromosome 9 (position 22529176)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21684962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATGGAGACCTTCMAAGAGAGAATAAGAGAAATCACTCGTGTACAGAT[A/T]AACAACCATCATCAGTCCATCATGAGACAGAGGAAACCTGTGTGGACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21467
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Essential Splice Site 835 1176 7 15
ENSDART00000131634   None 181 None 2
ENSDART00000137922 Essential Splice Site 852 1196 8 16
Genomic Location (Zv9):
Chromosome 9 (position 22528763)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21684549
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGGCTCATGCTCTTTGGGTGACATCTCTTCTTAAATGCCGTTTATGC[A/C]GATGTCAGGATGATTACTTTTACTCCAAGAGGCCAGTGTCCCCATTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Essential Splice Site 933 1176 8 15
ENSDART00000131634   None 181 None 2
ENSDART00000137922 Essential Splice Site 950 1196 9 16
Genomic Location (Zv9):
Chromosome 9 (position 22528198)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21683984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCCAAACCTTCCTCTTCACTACAGAGGAACAGTACCTATTAGTGATGT[G/A]TAAGTTAATGTCTTCTTCAGTGAACAACACTAGAGCATAGTTTGGCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Essential Splice Site 1055 1176 12 15
ENSDART00000131634   None 181 None 2
ENSDART00000137922 Essential Splice Site 1075 1196 13 16
Genomic Location (Zv9):
Chromosome 9 (position 22525575)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21681361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAGACCATGCCCTGAAATACTCTAAAGTCCTGCTAGACTACTTCAAG[G/T]TAGGCATTATTCAAGAGAAATGCCTACTAATGCTAAGTACAAACTGTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Essential Splice Site 1055 1176 12 15
ENSDART00000131634   None 181 None 2
ENSDART00000137922 Essential Splice Site 1075 1196 13 16
Genomic Location (Zv9):
Chromosome 9 (position 22525574)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21681360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGACCATGCCCTGAAATACTCTAAAGTCCTGCTAGACTACTTCAAGG[T/C]AGGCATTATTCAAGAGAAATGCCTACTAATGCTAAGTACAAACTGTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Nonsense 1059 1176 13 15
ENSDART00000131634   None 181 None 2
ENSDART00000137922 Nonsense 1079 1196 14 16
Genomic Location (Zv9):
Chromosome 9 (position 22525460)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21681246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACTTACCCATACATGTTTTATTACCTTTTTTAAATCAGAGTTCTCCA[A/T]AAGGACCTCACAACCCCCCTACAAGGAACGATTCTGGAAAGTAAGATACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link